Cúm a h7n9

Virus cúm A H7N9

Virus cúm A H7N9
... Khái quát virus cúm Virus cúm A/ H7N9 VI RUS CÚM Cúm bệnh truyền nhiễm cấp tính đường hô hấp virus cúm gây Virus cúm có type A, B C Virus dễ bị tiêu diệt nhiệt độ thường có sức sống dai dẳng nhiệt ... cúm A( H7N9) • • • • Tài liệu tham khảo China—WHO Joint Mission on Human Infection with Avian Influenza A( H7N9) Virus 18 – 24 April 2013 Mission Report WHO RISK ASSESSMENT Human infections with avian ... N2…) •VD: Cúm A – H1N1, H5N1, H7N3, H7N7, H7N9, Virus A/ H7N9 Virus cúm H7N9 thực thành viên dòng họ nhà virus cúm gia cầm A Có khả gây nhiễm cho người dẫn đến viêm phổi nặng tiến triển nhanh tỷ...
  • 16
  • 127
  • 0

nôị dung tuyên truyền về phòng chống bệnh cúm a (h5n1) cúm a (h7n9)

nôị dung tuyên truyền về phòng chống bệnh cúm a (h5n1) cúm a (h7n9)
... chống bệnh cúm A (H7N9) Hiện ch a có vắc xin phòng ng a nhiễm cúm A (H7N9) Vì để chủ động phòng chống bệnh cúm A (H7N9) cần thực biện pháp sau: - Tuyên truyền cho người dân bệnh cúm A (H7N9) ... với dịch bệnh - Vệ sinh, khử trùng sẽ chợ bán gia cầm - Buôn bán, vận chuyển gia cầm rõ nguồn gốc II Kiến thức cúm A (H7N9) Vi rút cúm A (H7N9) gì? Vi rút cúm A (H7N9) có nguồn gốc từ gia cầm, ... dụng biện pháp phòng bệnh như: - Khai báo tình trạng sức khoẻ cho quan y tế đ a phương để theo dõi sức khoẻ - Đối với người du lịch đến quốc gia có dịch bệnh cúm A (H5N1), cúm A (H7N9) tổ chức...
  • 4
  • 524
  • 3

ĐÁNH GIÁ một số đặc điểm các TRƯỜNG hợp BỆNH cúm a(h7n9) ở NGƯỜI tại TRUNG QUỐC và đài LOAN từ 29 3 30 4 2013

ĐÁNH GIÁ một số đặc điểm các TRƯỜNG hợp BỆNH cúm a(h7n9) ở NGƯỜI tại TRUNG QUỐC và đài LOAN từ 29 3  30 4 2013
... cỳm A(H7N9) ch yu trung Nam (72,2%) (Biu 3) T ngy 29/ 3/ 20 13 n ngy 30 /4/ 20 13 ó ghi nhn 126 ca mc cỳm A(H7N9) trờn phm vi rng (11 tnh/thnh ph ca Trung Quc v i Loan) (Hỡnh 1) Y HC THC HNH (8 74) ... oỏn v iu tr kp thi KT LUN T ngy 29/ 3/ 20 13 n ngy 30 /4/ 20 13 ó ghi nhn 126 ca mc cỳm A(H7N9) ti 11 tnh/thnh ph phớa ụng ca Trung Quc v i Loan Phn ln cỏc ca mc cỳm A(H7N9) Thng Hi, Giang Tụ, Chit ... Biu 3: phõn b cỏc ca mc cỳm A(H7N9) v t vong theo gii S ca mc cỳm A(H7N9) ch yu Nam (72,2%), t l cht Nam (20,9%) ln hn nhiu N ( 14 ,3% ) n ngy 30 /4/ 20 13 ó ghi nhn cỏc ca mc cỳm A(H7N9) ti...
  • 3
  • 80
  • 0

Kiến thức, thực hành và một số yếu tố liên quan về phòng dịch cúm A(H7N9) của cán bộ kiểm dịch 13 trung tâm kiểm dịch Y tế Quốc tế Việt Nam năm 2014

Kiến thức, thực hành và một số yếu tố liên quan về phòng dịch cúm A(H7N9) của cán bộ kiểm dịch 13 trung tâm kiểm dịch Y tế Quốc tế Việt Nam năm 2014
... cúm A (H7N9) cán kiểm dịch 13 Trung tâm Kiểm dịch y tế quốc tế Việt Nam năm 2014 Xác định số y u tố liên quan đến kiến thức, thực hành phòng dịch cúm A(H7N9) cán kiểm dịch 13 Trung tâm Kiểm dịch ... Kiến thức, thực hành số y u tố liên quan phòng dịch cúm A(H7N9) cán kiểm dịch 13 Trung tâm Kiểm dịch y tế quốc tế Việt Nam năm 2014 3 MỤC TIÊU NGHIÊN CỨU Mô tả kiến thức, thực hành phòng dịch ... tượng cán kiểm dịch y tế của 13 Trung tâm Kiểm dịch y tế quốc tế nước - Lãnh đạo 13 trung tâm kiểm dịch y tế quốc tế Tiêu chí chọn: kiểm dịch viên y tế công tác Trung tâm Kiểm dịch y tế quốc tế, ...
  • 97
  • 263
  • 0

Vi rus cum a h7n9 2

Vi rus cum a h7n9  2
... Infection with Avian Influenza A( H7N9) Virus 18 – 24 April 20 13 Mission Report WHO RISK ASSESSMENT Human infections with avian influenza A( H7N9) virus 10 May 20 13 www.moh.gov.vn www.vfa.gov.vn www.who.int/entity/influenza/human_animal_interface/influenza _h7n9 ... nhật đ a lên mạng Virus cúm A (H7N9) gì? Virus cúm gia cầm A H7 nhóm virus cúm thường lưu hành chim Virus cúm gia cầm A( H7N9) phân nhóm cu a nhóm virus H7 Mặc dù số loại virus H7 (H7N2, H7N3 ... lan cho 129 người Trung Quốc thời gian vư a qua loại virus tạo nên thông qua tái cấu trúc từ bốn loại virus khác Nghiên cứu cho thấy, gen cu a virus có khả bắt nguồn từ virus cúm A H7N9 xuất...
  • 14
  • 135
  • 0

Cúm a h7n9

Cúm a h7n9
... (NAI) – Oseltamivir – Zanamivir 15 04/03/2014 16 04/03/2014 Oseltamivir ức chế men neuraminidase cách tranh chấp phản ứng tách liên kết acid sialic Oseltamivir 17 04/03/2014 Oseltamivir Zanamivir ... triển nhanh, tỉ lệ tử vong cao • ðường lây truyền vi rút cúm A (H7N9) ch a ñược hiểu rõ ch a có chứng lây truyền vi rút từ người sang người • Ch a có trường hợp cúm A/ H7N9 ghi nhận Việt Nam 04/03/2014 ... hiệu sau 10 giây •T1/2 2.5 – 18 04/03/2014 ðiều trị Dịch cúm A( H7N9) có nguy xâm nhập, lan truyền bùng phát cao • Chủng vi rút cúm A( H7N9) ch a gây bệnh cho người • ðã phát vi rút cúm A( H7N9) ...
  • 20
  • 173
  • 0

giám sát cúm gia cầm type a h5n1 và a h7n9 trên gia cầm, thủy cầm sống được bán tại các chợ tại địa bàn thành phố hà nội và tỉnh ninh bình

giám sát cúm gia cầm type a h5n1 và a h7n9 trên gia cầm, thủy cầm sống được bán tại các chợ tại địa bàn thành phố hà  nội và tỉnh ninh bình
... virus cúm type A/ H5N1 gia cầm sống bán chợ thành phố Nội Bảng 3.7 Tỷ lệ nhiễm virus cúm type A/ H5N1 gia cầm sống bán chợ thành phố Nội qua tháng Kết xét nghiệm A Thời gian lấy mẫu A/ H5 A/ H5N1 ... 2,67 Kết xác định nhiễm virus cúm A/ H5N1 chợ Nội Bảng 3.6 Tỷ lệ nhiễm virus cúm type A/ H5N1 gia cầm sống bán chợ thành phố Nội Kết xét nghiệm A Chợ đầu mối A/ H5 A/ H5N1 Số mẫu xét nghiệm Số ... thủy cầm sống Bệnh cúm gia cầm chủng độc lực cao (HPAI) với nhiều subtype khác khả tổng hợp biến bán chợ đ a bàn chủng làm bệnh nguy hiểm thành phố Nội tỉnh Ninh Bình Gia cầm sống xác định đối...
  • 29
  • 396
  • 1

đánh giá lưu hành virus cúm a h5n1 và h7n9 trên thủy cầm sống bán tại các chợ ở một số tỉnh miền bắc bằng phương pháp realtime rt pcr

đánh giá lưu hành virus cúm a h5n1 và h7n9 trên thủy cầm sống bán tại các chợ ở một số tỉnh miền bắc bằng phương pháp realtime rt  pcr
... TGTCAATGGTTAAGGGCAACTC None None Probe FAM BHQ1 (China) TGGTTTAGCTTCGGGGCATCATG H7-6 Forward GYAGYGGYTACAAAGATGTG None None Reverse GAAGACAAGGCCCATTGCAA None None (CODA) Probe AGACAATCCCCGACCGAATGAATGACCC ... BHQ1 M-4 Forward CATGGARTGGCTAAAGACAAGACC None None Reverse AGGGCATTTTGGACAAAKCGTCTA None None H5-3S Probe TCA ACA GTG GCG AGT TCC CTA GCA HEX BHQ1 (AAHL+ Probe TCAACAGTTGCGAGTTCTCTAGCA TET (CDC) ... thủy cầm sống bán chợ số tỉnh miền Bắc phương pháp Realtime RT - PCR Mục tiêu ñề tài - Xác ñịnh ñược lưu hành virus cúm type A/ H5N1 H7N9 thủy cầm sống bán chợ tỉnh/ thành phố bao gồm: tỉnh Ninh...
  • 85
  • 65
  • 1

Hướng dẫn :Chẩn đoán, điều trị và phòng lây nhiễm cúm A (H1N1)

Hướng dẫn :Chẩn đoán, điều trị và phòng lây nhiễm cúm A (H1N1)
... sàng cúm - Xét nghiệm dơng tính khẳng định nhiễm vi rút cúm A (H1N1) c) Ngời lành mang vi rút: Không có biểu lâm sàng nhng xét nghiệm có cúm A (H1N1) Những trờng hợp phải đợc báo cáo II điều trị ... xâm nhập e) Phát điều trị suy a phủ tạng g) Những trờng hợp nặng điều trị giống nh cúm A (H5N1) nặng đợc Bộ Y tế ban hành Tiêu chuẩn viện: a) Nơi xét nghiệm Real time RT-PCR: - Sau hết sốt ngày ... đợc hớng dẫn, đăng ký áp dụng biện pháp phòng lây nhiễm nh nhân viên y tế Phòng ng a cho nhân viên y tế: - R a tay thờng quy trớc sau thăm khám ngời bệnh xà phòng dung dịch sát khuẩn nhanh - Phơng...
  • 6
  • 337
  • 1

Kinh nghiệm lâm sàng chẩn đoán và điều trị viêm phổi virus cúm a (h5n1) tại viện y học lâm sàng các bệnh nhiệt đới

Kinh nghiệm lâm sàng chẩn đoán và điều trị viêm phổi virus cúm a (h5n1) tại viện y học lâm sàng các bệnh nhiệt đới
... người nhà an tâm tin tưởng điều trị tuân thủ tốt y u cầu cách ly V Kết luận - Viêm phổi virus Cúm A (H5N1) có biểu lâm sàng a dạng Việc chẩn đoán bệnh d a y u tố dịch tễ, lâm sàng xét nghiệm Khẳng ... bệnh nhiễm virus Cúm A (H5N1) viêm phổi nặng tử vong 26,8% + Không phát y u tố phơi nhiễm 14,6% - Tuy ca bệnh tản phát có xu hướng nhóm ca bệnh gia đình Có nhóm ca bệnh gia đình, nhóm có ca bệnh ... Kết c y bệnh phẩm đường hô hấp có Acinetobacter baumannii, Pseudomonas aeruginosa… Những vi khuẩn a kháng kháng sinh thử kháng sinh đồ III Chẩn đoán - Chẩn đoán bệnh sơ d a việc kết hợp y u tố...
  • 8
  • 589
  • 5

Bài giảng: Viêm phổi virus cúm a (h5n1)

Bài giảng: Viêm phổi virus cúm a (h5n1)
... nhân nhiễm virus cúm A/ H5N1 điều trị oseltamivir - Virus cúm A/ H5N1 phân lập từ năm 2003 kháng mạnh với amantadine rimantadine - Ribavirin ức chế virus cúm A B cho thấy có tác dụng kháng virus bổ ... nghiệm virus cúm A/ H5N1 dương tính 6.2 Chẩn đoán phân biệt - Cúm thông thường - Viêm phổi không điển hình vi khuẩn Chlamydia, Legionella, Mycoplasma 13 Khoa HSCC Lây 8-9 Viện YHLSCBNĐ Viêm phổi virus ... Lan, Cam-pu-chia Indonesia (Bảng) Khoa HSCC Lây 8-9 Viện YHLSCBNĐ Viêm phổi virus CÚM A/ H5N1 Bảng: Số tích lũy ca nhiễm tử vong tính đến 14/11/2005 (WHO) Thời gian Indonesia Việt Nam Thái Lan...
  • 22
  • 617
  • 5

Xác định trình tự và phân tích gen mã hóa kháng nguyên HA của virus cúm chủng NIBRG-14 sử dụng trong sản xuất vacine cúm A/H5N1 tại Việt Nam

Xác định trình tự và phân tích gen mã hóa kháng nguyên HA của virus cúm chủng NIBRG-14 sử dụng trong sản xuất vacine cúm A/H5N1 tại Việt Nam
... phân tích gen hóa kháng nguyên HA virus cúm chủng NIBRG-14 sử dụng sản xuất vacine cúm A/H5N1 Việt Nam Đề tài góp phần ứng dụng vào việc sản xuất vacine cúm A/H5N1, phòng bệnh gia cầm Việt Nam ... bệnh Việt Nam - Đã phân tích trình tự đoạn gen hóa cho kháng nguyên HA cúm chủng NIBRG-14 sử dụng sản xuất vaccine cúm A/H5N1 Việt Nam ĐỀ NGHỊ: Tiếp tục nghiên cứu sử dụng kháng nguyên kháng ... tiễn: - Ý nghĩa khoa học: Xác định trình tự gen hóa kháng nguyên HA chủng NIBRG-14 sử dụng sản xuất vacine - Ý nghĩa thực tiễn: Sử dụng chủng NIBRG-14 vào việc sản xuất vacine Đối tượng phạm vi...
  • 47
  • 461
  • 2

Cúm A H1N1

Cúm A H1N1
... uz cr Ve a ac ax can O a ho to ic a M ju na ua r o G ta re ue Q la eb P u go an ur D as ap hi o C er rr ue G a im ua ol h C ua tes n ch hi alie C c as gu A la a ca rni ax ifo Tl al C a aj B si ... Seyed Amir Ebrahimzadeh, Tehran University of Medical Sciences, Iran Dr Nasrin Rahimian, Tehran University of Medical Sciences, Iran Dr Mohd Hasni , University of Kebangsaan, Malaysia Dr Kawkab ... USA Dr Nicolás Padilla Raygoza, Universidad de Guanajuato, México Dr Ali Ardalan, Tehran University of Medical Sciences, Iran Dr Mehrdad Mohajery, Tehran University of Medical Sciences, Iran...
  • 47
  • 321
  • 0

Đánh giá khả năng đáp ứng miễn dịch của đàn gia cầm sau khi tiêm phòng vaccine cúm A/H5N1 tại tỉnh Nghệ An

Đánh giá khả năng đáp ứng miễn dịch của đàn gia cầm sau khi tiêm phòng vaccine cúm A/H5N1 tại tỉnh Nghệ An
... Đánh giá khả đáp ứng miễn dịch đàn gia cầm sau tiêm phòng vaccine cúm A/H5N1 tỉnh Nghệ An 1.2 Mục tiêu đề tài Mục tiêu đề tài xác định hiệu giá kháng thể gà, vịt sau tiêm phòng vaccine cúm A/H5N1 ... Đáp ứng miễn dịch đặc hiệu Cả hai nhánh đáp ứng miễn dịch thu đáp ứng miễn dịch dịch thể đáp ứng miễn dịch qua trung gian tế bào đóng vai trò chế thực đặc hiệu miễn dịch chống virus Các đáp ứng ... Vinh, Nghệ An 3.3 Nội dung nghiên cứu - Đánh giá khả đáp ứng miễn dịch đàn đàn vịt sau tiêm phòng vaccine đợt đợt - So sánh tỷ lệ bảo hộ gà vịt sau tiêm phòng vaccine - Đáp ứng miễn dịch gà...
  • 65
  • 340
  • 0

Xem thêm

Từ khóa: phác đồ điều trị cúm a h7n9điều trị cúm a h7n9hướng dẫn chẩn đoán điều trị cúm a h7n9hướng dẫn điều trị cúm a h7n9hướng dẫn chẩn đoán và điều trị cúm a h7n9phác đồ điều trị cúm a h7n9 của bộ y tếtriệu chứng dịch cúm a h7n9giáo trình điều trị cúm atài liệu điều trị cúm ahướng dẫn điều trị cúm aphương pháp điều trị cúm aphòng tránh lây lan cúm a h1n1đặc điểm sinh học cúm ađiều trị cúm abài giảng điều trị cúm amẫu báo cáo thực tập CBKTLLDHDH CA handout trong thực hành giảng dạyAnalysis of korean students international mobility by 2 d modelGDDH the gioi va vietnam moiBình luận ưu nhược điểm của các Hiệp định thương mại tự do (FTA) và liên hệ với Khu vực thương mại tự do ASEANtìm hiểu khái niệm về án lệĐề cương quản lí nghànhFactors influencing purchasing behavior of counterfeit productsRelationship between corporation social responsibility, brand equity, company reputation and customer company identification in ho chi minh city hotel industryAdvanced Grammar TestToi uu tham so he moBài 5 tổng hợp hai dao động điều hòa cùng phương, cùng tần số phương pháp giản đồ frenenBài 7 sóng cơ và sự truyền sóng cơBài 8 giao thoa sóngKỷ yếu công trình nghiên cứu khoa học 1995 2001 (viện pasteur nha trang)English Phonetics and PhonologyÔn tập toán 7 lên lớp 8VNUEPT speaking chủ đề và bài soạn (1)TÀI LIỆU ôn THI môn bào CHẾ NGÀNH y dượcKhai thác bài tập toán phần công thức biến đổi lượng giác (Khóa luận tốt nghiệp)
Đăng ký
Đăng nhập