Acute lymphoblastic leukemia (all)

báo cáo hóa học: " Health-related quality of life assessment in Indonesian childhood acute lymphoblastic leukemia" potx

báo cáo hóa học:
... ALL: acute lymphoblastic leukemia; HRQOL: healthrelated quality of life; PedsQL™: the Pediatric Quality of Life Inventory™ Competing interests The authors declare that they have no competing interests ... Y: Measuring health-related quality of life in Greek children: psychometric properties of the Greek version of the Pediatric Quality of Life Inventory(TM) 4.0 Generic Core Scales Qual Life Res ... survival: quality of life and follow-up after childhood cancer J Pediatr Psychol 2007, 32:1140-50 Varni JW, Burwinkle TM, Lane MM: Health-related quality of life measurement in pediatric clinical...
  • 8
  • 159
  • 0

báo cáo hóa học: " Impaired sleep affects quality of life in children during maintenance treatment for acute lymphoblastic leukemia: an exploratory study" pdf

báo cáo hóa học:
... a decrease in mortality and an increased attention for the burden of treatment for both the patient and family QoL is impaired in children during cancer treatment, and the results of this study ... children during maintenance treatment for acute lymphoblastic leukemia: an exploratory study Health and Quality of Life Outcomes 2011 9:25 Submit your next manuscript to BioMed Central and take ... confirm these findings and provide more detailed information on the relationship between sleep and QoL, and on factors affecting sleep in pediatric ALL and in children with cancer in general Abbreviations...
  • 7
  • 128
  • 0

báo cáo hóa học:" Health-related quality of life assessment in Indonesian childhood acute lymphoblastic leukemia" docx

báo cáo hóa học:
... ALL: acute lymphoblastic leukemia; HRQOL: healthrelated quality of life; PedsQL™: the Pediatric Quality of Life Inventory™ Competing interests The authors declare that they have no competing interests ... Y: Measuring health-related quality of life in Greek children: psychometric properties of the Greek version of the Pediatric Quality of Life Inventory(TM) 4.0 Generic Core Scales Qual Life Res ... survival: quality of life and follow-up after childhood cancer J Pediatr Psychol 2007, 32:1140-50 Varni JW, Burwinkle TM, Lane MM: Health-related quality of life measurement in pediatric clinical...
  • 8
  • 148
  • 0

Báo cáo khoa học: "Mitochondrial DNA alterations of peripheral lymphocytes in acute lymphoblastic leukemia patients undergoing total body irradiation therapy" ppt

Báo cáo khoa học:
... DNA alterations of peripheral lymphocytes in acute lymphoblastic leukemia patients undergoing total body irradiation therapy Quan Wen1, Yide Hu1§, Fuyun Ji2, Guisheng Qian2 Third Department of ... leukemia (ALL) patients undergoging total body irradiation (TBI) precondionting as human beings in vivo irradiation model The advantage of using this model lies in full view of in vivo microenvironment, ... are key indicators of irradiation- induced damage The relationship between total body irradiation (TBI) treatment and mtDNA alterations in vivo, however, has not been postulated yet The aim of this...
  • 25
  • 108
  • 0

báo cáo khoa học: " Plasma levels of leptin and soluble leptin receptor and polymorphisms of leptin gene -18G A and leptin receptor genes K109R and Q223R, in survivors of childhood acute lymphoblastic leukemia" docx

báo cáo khoa học:
... was to determine the polymorphisms of leptin and leptin receptor genes and plasma levels of leptin and leptin soluble receptors in survivors of childhood ALL The study assessed the influence of ... arcuate nucleus In some cells of hypothalamus, leptin and insulin activate both JAK-STAT and PI3K signaling pathways Additionally, both enzymes terminating leptin and insulin function – SOCS3 and ... Genotyping method used (restriction enzyme) Leptin gene - 18G > A tggagccccgtaggaatcgca tgggtctgacagtctcccaggga PCR-RFLP (AciI) Leptin receptor gene - K109R tttccactgttgctttcgga aaactaaagaatttactgttgaaacaaatggc...
  • 9
  • 130
  • 0

báo cáo khoa học: "Persistence of TEL-AML1 fusion gene as minimal residual disease has no additive prognostic value in CD 10 positive B-acute lymphoblastic leukemia: a FISH study" doc

báo cáo khoa học:
... disease TEL-AML1 fusion as a minimal residual disease Kaplan-Meier curve for the persistence of TEL-AML1 fusion as a minimal residual disease (MRD) as a predictor of overall cumulative survival after ... Satake N, Sakashita A, Kobayashi H, Maseki N, Sakurai M, Kaneko Yl: Minimal residual disease with TEL-AML1 fusion transcript in childhood acute lymphoblastic leukemia with t(12;21) Br J Haematol ... It was measured in newly diagnosed cases (Table 1) and it was positive in 30/80 (37.5%) determining its frequency in B-lineage ALL positive for CD 10 and CD 19 The mean percent of TEL-AML1 fusion...
  • 7
  • 73
  • 0

báo cáo khoa học: "SET-NUP214 fusion in acute myeloid leukemia- and T-cell acute lymphoblastic leukemia-derived cell lines" ppsx

báo cáo khoa học:
... leukemia/lymphoma cell lines of T-, B- and myeloid cell origin to detect SET-NUP214 positive examples A T-ALL cell line LOUCY (1/43 T cell lines tested) and an AML cell line MEGAL (1/53 myeloid cell lines ... del(9)(q34.11q34.13) in cell lines LOUCY and Deletion del(9)(q34.11q34.13) in cell lines LOUCY and MEGAL Sequencing identified SET exon 7/NUP214 exon 18 fusion mRNA in both cell lines Genomic sequencing located ... breakpoint to regions downstream of the stop codon of SET and to intron 17/18 of NUP214 in both cell lines AC-3' For the determination of genomic SET and NUP214 breakpoints in cell lines LOUCY and...
  • 5
  • 55
  • 0

báo cáo khoa học: "Analysis of the expression pattern of the BCL11B gene and its relatives in patients with T-cell acute lymphoblastic leukemia" doc

báo cáo khoa học:
... clarify the role of BCL11B in T-cell malignancies, we further analyzed the expression levels of TNFSF10, BCL2L1, SPP1, and CREBBP genes and their correlations with BCL11B in patients with T-ALL and ... of the SPP1 gene in T-cell malignancies is unclear, because low expression of SPP1 was detected in T-ALL Conclusions The expression pattern of the BCL11B gene and four of its related genes (TNFSF10, ... electrophoresis analysis The size of the PCR products of the b2M gene used for the BCL11B reference is 332 bp (line 1, 2) and that used for the four genes of interest is 145 bp (line 4-11) Line 3: DNA ladder...
  • 7
  • 141
  • 0

Báo cáo y học: " Precursor B-cell acute lymphoblastic leukemia presenting as obstructive jaundice: a case report" pdf

Báo cáo y học:
... B-cell acute lymphoblastic leukemia presenting as obstructive jaundice: a case report Journal of Medical Case Reports 2011 5:269 Submit your next manuscript to BioMed Central and take full advantage ... (alanine transaminase 74I U/L and aspartate transaminase 52I U/L) His alkaline phosphatase and g-glutamyl transferase levels were significantly raised at 293I U/L and 327I U/L, respectively This profile ... 42:1181-1186 Rajesh G, Sadasivan S, Hiran KR, Nandakumar R, Balakrishnan V: Acute myeloid leukemia presenting as obstructive jaundice Indian J Clin Gastroenterol 2006, 25:93-94 10 Comeau TB, Phillips...
  • 4
  • 142
  • 0

Báo cáo y học: "Acute lymphoblastic leukemia subsequent to temozolomide use in a 26-year-old man: a case report." doc

Báo cáo y học:
... transforming in undifferentiated leukemia [3,5] and one report of Ph negative T-ALL in a patient receiving treatment [6] TMZ is an oral alkylating agent that is now known to be active against a ... variety of CNS neoplasms After oral absorption, it spontaneously hydrolyzes to methyltriazen-1-yl imidazole-4-carboxamide (MTIC) MTIC degrades to a highly reactive cation that methylates guanines ... Eisenhauer E, Mirimanoff RO, European Organisation for Research and Treatment of Cancer Brain Tumor and Radiotherapy Groups; National Cancer Institute of Canada Clinical Trials Group: Radiotherapy...
  • 3
  • 140
  • 0

Báo cáo y học: "Acute lymphoblastic leukemia subsequent to temozolomide use in a 26-year-old man: a case report" potx

Báo cáo y học:
... transforming in undifferentiated leukemia [3,5] and one report of Ph negative T-ALL in a patient receiving treatment [6] TMZ is an oral alkylating agent that is now known to be active against a ... variety of CNS neoplasms After oral absorption, it spontaneously hydrolyzes to methyltriazen-1-yl imidazole-4-carboxamide (MTIC) MTIC degrades to a highly reactive cation that methylates guanines ... Eisenhauer E, Mirimanoff RO, European Organisation for Research and Treatment of Cancer Brain Tumor and Radiotherapy Groups; National Cancer Institute of Canada Clinical Trials Group: Radiotherapy...
  • 3
  • 130
  • 0

Báo cáo y học: " Challenges in implementing individualized medicine illustrated by antimetabolite therapy of childhood acute lymphoblastic leukemia" ppt

Báo cáo y học:
... determined by the therapy- disease interaction, i.e the drug resistance of the invading microorganism Accordingly, benefits of individualized medicine are expected to be modest and mostly financial, ... chemotherapy Curr Opin Pediatr 2007, 19:15-22 doi:10.1186/1559-0275-8-8 Cite this article as: Nersting et al.: Challenges in implementing individualized medicine illustrated by antimetabolite therapy ... characteristics of the leukemic clone (e.g lineage, cytogenetics, and tumor burden) In recent years this has been refined by adding monitoring of the early response to induction chemotherapy (i.e monitoring...
  • 12
  • 66
  • 0

Relapse prediction in childhood acute lymphoblastic leukemia by time series gene expression profiling

Relapse prediction in childhood acute lymphoblastic leukemia by time series gene expression profiling
... RELAPSE PREDICTION IN CHILDHOOD ACUTE LYMPHOBLASTIC LEUKEMIA BY TIME- SERIES GENE EXPRESSION PROFILING DIFENG DONG (B COMP., FUDAN UNIVERSITY) A THESIS ... modeling and relapse prediction in childhood ALL  We generate the first time- series GEPs in leukemia The data are collected at the time of diagnosis, and days, 15 days and 33 days after the initial ... 2.2 13 Gene Expression Profiling Gene expression profiling (GEP) refers to the microarray technology, invented in the mid 1990s, that allows monitoring the activity of tens of thousands of genes...
  • 141
  • 29
  • 0

Xem thêm

Nạp tiền Tải lên
Đăng ký
Đăng nhập