Tài liệu Báo cáo khóa học: The effect of mutations surrounding and within the active site on the catalytic activity of ricin A chain pptx

Tài liệu Báo cáo khóa học: The effect of mutations surrounding and within the active site on the catalytic activity of ricin A chain pptx
... IMAGEQUANT software, and depurination was calculated by relating the amounts of the small aniline-fragment and 5.8S rRNA and expressing values as a percentage Reassociation and quantification of ... carried out for each individual atom Data collection and refinement statistics are given in Table Assay of the N-glycosidase activity of ricin A chain variants The activity of each of the RTA ... To assess the effect of substitutions made at each of the arginyl residues on catalytic activity of RTA, the ability of each of the purified RTA variants to depurinate yeast ribosomes was compared...
  • 10
  • 225
  • 0

Báo cáo sinh học: " Research Article Spectrally Efficient OFDMA Lattice Structure via Toroidal Waveforms on the Time-Frequency Plane" doc

Báo cáo sinh học:
... doughnut-shapes on the time-frequency plane Hence, the algorithm constitutes a toroidal waveform structure on the time-frequency plane Figure presents the waveform of the system in timefrequency plane for the ... transmission The figure shows time-frequency regions are occupied by HermiteGaussian functions of orders i = 0, 1, 2, Therefore, linear combinations of them at different orders constitute a toroidal structure ... rectangular time-frequency region in advance Afterwards, we shift the signal to the baseband and obtain the toroidal lattice structure which contains multiple data We take inner products of the toroidal- data...
  • 8
  • 116
  • 1


... Information Center | Copyright by Vietnam Internet Network Information Center | REPORT ON VIETNAM INTERNET RESOURCES 2013 REPORT ON VIETNAM INTERNET RESOURCES 2013 ... Internet Network Information Center | Copyright by Vietnam Internet Network Information Center | REPORT ON VIETNAM INTERNET RESOURCES 2013 REPORT ON VIETNAM INTERNET ... by Vietnam Internet Network Information Center | Copyright by Vietnam Internet Network Information Center | REPORT ON VIETNAM INTERNET RESOURCES 2013 REPORT...
  • 38
  • 57
  • 1

báo cáo khoa học: "Reactivating aberrantly hypermethylated p15 gene in leukemic T cells by a phenylhexyl isothiocyanate mediated inter-active mechanism on DNA and chromatin" potx

báo cáo khoa học:
... F:ctacaatgagctgcgtgtggc R:caggtccagacgcaggatggc p15 DNMT1 R:ggtttgacttcggagtctct DNMT 3A F:cacacagaagcatatccaggagtg R:agtggactgggaaaccaaataccc DNMT3B F:aatgtgaatccagccaggaaaggc R:actggattacactccaggaaccgt F: Forward ... F:gtggggcgccccaggcacca 517 Variable 271 Variable F:tgggggcggcagcgatgag R:aggtgggtgggggtgggaaat 451 56 F:accatcacatctcattttgc 238 56 551 55 190 55 R:ctccttaatgtcacgcacgatttc actin2 F:ctacaatgagctgcgtgtggc ... demonstrated that PHI has a dual effect on DNA methylation and histone acetylation in leukemic T cells Molt-4 The cross-talk on the DNA and chromatin resulted in demethylating the CpG island...
  • 6
  • 97
  • 0

Role of bcl 2 in metabolic and redox regulation via its effects on cytochrome c oxidase and mitochondrial functions in tumor cells

Role of bcl 2 in metabolic and redox regulation via its effects on cytochrome c oxidase and mitochondrial functions in tumor cells
... treated CEM /Bcl- 2 cells Indeed, if MnSOD was engaged in blunting mitochondrial O2- increase in antimycin-treated CEM /Bcl- 2 cells due to increased activity in the context of Bcl- 2 overexpression, ... a conformational change in Bcl- 2, exposing its BH3 domain, converting Bcl- 2 from anti-apoptotic to pro-apoptotic (Lin, Kolluri et al 20 04) 1.6 Non-canonical role of Bcl- 2 in redox regulation: ... increases in COX activity and oxygen consumption This observation corresponded to the maintenance of mitochondrial O2- levels in the Bcl- 2 cells while the levels in nonoverexpressing cells continue...
  • 78
  • 48
  • 0


... PC and controls, control devices remotely We use Yahoo server to connect Center PC to Remote PC Center PC send commands to Remote PC via Yahoo Messenger After receiving command of Center PC, Remote ... (storage and graph) 1.4 Model connection for collecting data from remote sensor using internet Home PC Internet RS232 RS232 Remote PC Remote Center Sensor RS232 Extended Remote Sensor1 Extended Remote ... containing commands (SMS) to Remote Mobile Remote Mobile is a cell phone connected with the board having sensors This board collects parameters from sensor, then transfers to Remote Mobile and Remote...
  • 35
  • 169
  • 0

Intelligent Software Agents on the Internet: an inventory of currently offered functionality in the information society & a prediction of (near-)future developments

Intelligent Software Agents on the Internet: an inventory of currently offered functionality in the information society & a prediction of (near-)future developments
... size of the Internet, let alone to make an estimation of the amount of information that is available on or through it; • The dynamic nature of the information on Internet: information that cannot ... Theory Intelligent Software Agents in Practise Intelligent Software Agents in Practise 3.1 Applications of Intelligent Agents The current applications of agents are of a rather experimental and ad ... other form of understanding and reasoning about what a user wants done, and planning the means to achieve this goal Further out on the intelligence scale are systems that learn and adapt to their...
  • 97
  • 347
  • 3

Báo cáo y học: "Clinical Symptoms Associated with Asystolic or Bradycardic Responses on Implantable Loop Recorder Monitoring in Patients with Recurrent Syncope"

Báo cáo y học:
... in the research phase In conclusion, chorioretinal involvement, frequently asymptomatic and self-limited, is present in almost 80% of patients with WNV infection associated with neurologic disease ... M, Ben Yahia S, Ladjimi A, et al Chorioretinal involvement in patients with West Nile virus infection Ophthalmology 2004;111:2065-70 Garg S, Jampol LM Systemic and intraocular manifestations of ... the routine evaluation of patients with clinically suspected WNV infection References Hayes EB, Gubler DJ West Nile virus: epidemiology and clinical features of an emerging epidemic in the United...
  • 2
  • 172
  • 0

Báo cáo y học: "Clinical Symptoms Associated with Asystolic or Bradycardic Responses on Implantable Loop Recorder Monitoring in Patients with Recurrent Syncope"

Báo cáo y học:
... response on ILR monitoring Group 2= Patients without asystolic or bradycardic response on ILR monitoring Symptoms (Table and Figure 1) Aura or prodrome: Only thirteen percent of patients in group1 ... characteristics of patients with asystolic or bradycardic responses during ILR monitoring (Group 1) are compared with those without asystolic or bradycardic responses (Group 2) in Table Eleven patients ... 22 patients, 14 had an arrhythmic etiology Eleven patients had bradyarrhythmia on ILR monitoring Our study is unique as the clinical symptoms of the syncope in patients with bradyarrhythmic responses...
  • 5
  • 212
  • 0

Đề án Khai thác thông tin Marketing qua internet (Gathering Marketing Information via Internet)

Đề án Khai thác thông tin Marketing qua internet  (Gathering Marketing Information via Internet)
... cận nguồn thông tin phục vụ cho kinh doanh marketing qua internet Ứng dụng kỹ tìm kiến thông tin để giúp tìm kiếm thông tin thứ cấp phục vụ cho công tác lập kế hoạch kinh doanh marketing nhiều ... • • H Đánh giá kết học tập môn Thuyết minh cách đánh giá kết học tập Sinh viên thực đề án đánh giá loại hình: 1) Thực đề án Sinh viên ... nghiên cứu thức Đề án thực qua bước: • Bước 1: Xác định tên đề tài mục tiêu nghiên cứu • Bước 2: Lập kế hoạch nghiên cứu, lập đề cương nghiên cứu • Bước 3: Tiến hành tập hợp thông tin nhằm đáp ứng...
  • 5
  • 207
  • 0

Nghiên cứu xây dựng một trang bán sách trên Internet dựa trên công nghệ Active Server Page (ASP )

Nghiên cứu xây dựng một trang bán sách trên Internet dựa trên công nghệ Active Server Page (ASP )
... Nghiên cứu xây dựng trang bán sách Internet dựa công nghệ ASP CHƯƠNG II MICROSOFT WEB SERVER VÀ CÁC MỨC CÔNG NGHỆ I INTERNET INFORMATION SERVER (IIS) Internet Information Server (IIS) Web server ... tắt ARPA) xây dựng dự án nối kết trung tâm nghiên cứu lớn toàn liên bang , mở đầu bốn sở : Viện nghiên cứu Stadford, Đại học California Nghiên cứu xây dựng trang bán sách Internet dựa công nghệ ... Web server đáp ứng yêu cầu Web browser cách trả lại trang HTML Trang trả lại trang HTML tĩnh, trang HTML động trang danh sách thư mục Nghiên cứu xây dựng trang bán sách Internet dựa công nghệ...
  • 95
  • 224
  • 0

Nghiên cứu xây dựng một trang bán sách trên Internet dựa trên công nghệ Active Server Page (ASP )”.

Nghiên cứu xây dựng một trang bán sách trên Internet dựa trên công nghệ Active Server Page (ASP )”.
... 0918.775.368 Nghiên cứu xây dựng trang bán sách Internet dựa công nghệ ASP CHƯƠNG II MICROSOFT WEB SERVER VÀ CÁC MỨC CÔNG NGHỆ I INTERNET INFORMATION SERVER (IIS) Internet Information Server (IIS) Web server ... 0918.775.368 Nghiên cứu xây dựng trang bán sách Internet dựa công nghệ ASP - Khi có sách nhập vào kho, vào hoá đơn nhập sách để cập nhật thông tin sách vào sở liệu Những thông tin bao gồm: tên sách, ... 0918.775.368 Nghiên cứu xây dựng trang bán sách Internet dựa công nghệ ASP II SỰ TIẾN TRIỂN CỦA WEB Trang HTML túnh -> HTML ủoọng -> trang ASP Nội dung liên kết tĩnh Web ban đầu dựa nội dung...
  • 95
  • 197
  • 0

Developing Writing Skills in a Foreign Language via the Internet.doc

Developing Writing Skills in a Foreign Language via the Internet.doc
... acquainted with the configuration of this genre, learners can model their own work in this area of academic writing The Internet The Internet has made many opportunities available to both learners ... keypals, and mailing lists just to name a few And, at our very fingertips are assorted, authentic materials whose access are not limited to either temporal or spatial constraints, for the Internet ... Learners can easily access web sites by simply using a familiar search engine (Google, Yahoo) and typing in the subject they wish to secure more details about As an example, once again referring...
  • 5
  • 194
  • 0

3G Marketing on the Internet

3G Marketing on the Internet
... get into the “Members Only” section, go to the Maximum Press Web site located at and follow the links to the companion Web site for 3G Marketing on the Internet section When ... chapter we look at: • Consumers and the Internet 3G Marketing on the Internet • Evolving Technology • Business and the Internet • Resources for Research Consumers and the Internet We’re a demanding ... with each other In the office environment, people will sooner e-mail the person sitting next to them than turn around and talk How Big Is the Internet Population? The year 2005 has seen the Web...
  • 211
  • 142
  • 0

Xem thêm

Từ khóa: Giám sát xây lắp điệnĐề tài NCKH cấp Bộ Nghiên cứu tác động ảnh hưởng của hàng rào kỹ thuật thương mại (TBT) Nhật Bản đối với xuất khẩu hàng nông, lâm, thuỷ sản của Việt nam và giải pháp khắc phụcĐề tài NCKH cấp Bộ Xây dựng dữ liệu phục vụ tra cứu, tìm kiếm thông tin khoa học và công nghệ và thị trường cho các nhóm ngành hàng thuộc ngành hóa chấtĐề tài Nghiên cứu chẩn đoán và xử trí chửa ngoài tử cung năm 2008 và năm 2003 tại bệnh viện Phụ sản Trung ươngĐề tài Nghiên cứu đặc điểm lâm sàng, cận lâm sàng và kết quả phẫu thuật vá nhĩ của viêm tai giữa mạn tínhĐề tài nghiên cứu khoa học Ảnh hưởng của thiết kế bao bì thực phẩm tới sự kỳ vọng của người tiêu dùng về thực phẩm chất lượngĐề tài nghiên cứu khoa học Các giải pháp đồng bộ phát triển nhà ở người thu nhập thấp tại các đô thị Việt NamĐề tài nghiên cứu khoa học Huy động vốn tại ngân hàng thương mại cổ phần công thương Việt Nam chi nhánh Phú ThọĐề tài nghiên cứu khoa học Mối quan hệ giữa biến động tỷ giá hối đoái và kim ngạch xuất khẩu Việt Nam bằng cách ứng dụng phương pháp ARDLĐề tài Nghiên cứu khoa học sư phạm ứng dụng Sử dụng thiết bị Hi_Class trong việc giảng dạy Tin học 10 nhằm nâng cao hứng thú học cho học sinhĐề tài nghiên cứu khoa học Xác định bệnh do trùng bào tử sợi (Myxosporea) gây ra ở cá chẽm Lates calcarifer(Bloch, 1790) giai đoạn giống và thử nghiệm phương pháp chữa trịĐề tài nghiên cứu Nghiên cứu ảnh hưởng của một số vật liệu tủ gốc đến sinh trưởng và năng suất của giống chè TRI777 trong vụ Xuân năm 2012 tại xã La Bằng, huyện Đại Từ, tỉnh Thái NguyênĐề tài Nghiên cứu và thiết kế máy chẻ tre công nghiệpĐề tài nhập môn Tìm hiểu về công nghệ sạc không dâyĐề tài Phân tích kĩ thuật máy chụp X-Quang số (CR&&DR)Đề tài Phẫu thuật nội soi cắt lách trong điều trị nang láchĐề tài Phương pháp phân tích địa hóa dầu khíĐề tài Quản lý tour du lịchĐề tài Quản lý trung tâm giới thiệu việc làmĐề tài Quản lý tuyển sinh đại hoc
Nạp tiền Tải lên
Đăng ký
Đăng nhập