Khóa luận Quy trình chẩn đoán viêm gan C bằng kỹ thuật PCR Elisa và Real Time PCR

“Xác định type nồng độ virus gây viêm gan C bằng kỹ thuật Realtime RTPCR trên BN viêm gan virus C tại Bệnh viện đa khoa Trung ương Cần Thơ”

“Xác định type và nồng độ virus gây viêm gan C bằng kỹ thuật Realtime RTPCR trên BN viêm gan virus C tại Bệnh viện đa khoa Trung ương Cần Thơ”
... định type nồng độ virus gây viêm gan C kỹ thuật Realtime RT-PCR BN viêm gan virus C Bệnh viện đa khoa Trung ương C n Thơ 1.2.2 M c tiêu c thể - X c định tỉ lệ (+) HCV qua kỹ thuật Realtime RT-PCR ... định type nồng độ virus gây viêm gan C kỹ thuật Realtime RT-PCR BN viêm gan virus C Bệnh viện đa khoa Trung ương C n Thơ” nhằm m c tiêu sau: 1.2 M c tiêu đề tài 1.2.1 M c tiêu tổng quát X c định ... nghiên c u x c định nồng độ type HCV kỹ thuật Realtime RT-PCR 168 BN Bệnh viện Đa khoa Trung ương C n Thơ, c số kết luận sau: Tỷ lệ HCVRNA (+) kỹ thuật Realtime RT-PCR 56%; nam chiếm 54%, nữ chiếm...
  • 68
  • 157
  • 0

Xác định kiểu gen virut viêm gan c trong huyết thanh bệnh nhân viêm gan c bằng kỹ thuật sinh học phân tử real timePCR

Xác định kiểu gen virut viêm gan c trong huyết thanh bệnh nhân viêm gan c bằng kỹ thuật sinh học phân tử real time – PCR
... trình tự gen type 6h (Hình 3.8) 78 HCV GAGGTACTTGCCACATATTGCGGCTTTCCCTCCTTGGGCGATAAGTTTGGCCC TGACCGCTCGGGCTCGGTGTCTCCAAGCTCTCAAGGGAGGAGCCCCAAGTTTTCT GAGGCATGATGCCACCCGATTGAGTTCGCCGGGAGAGTACCCATGGAGTGAGAA ... TGCGGCCATGCCGTGGAGTCTTTGAATGATCACTGGGAGATCAAGCGGAGTGATT GAATATGTGACTCCGTAGATATCGAAGTCAAGTGCCCTGTCCAAAGTCTCCTGTG CCTGGAGTATTTGAAAGAAATGGGTCATGAGTACCATACGCACCCAAATGGTGG GGGCATACATAATGATGTTCCCTAACCATGAATTCACAGGAGTGTGGCGAGCGGT ... Với m c đích khuyến c o bệnh nhân lựa chọn phương pháp x c định genotype, chọn đề tài: X c định kiểu gen virus viêm gan C huyết bệnh nhân viêm gan C kỹ thuật sinh h c phân tử RT -PCR , với m c tiêu...
  • 19
  • 403
  • 1

ác định kiểu gen virus viêm gan c trong huyết thanh bệnh nhân viêm gan c bằng kỹ thuật sinh học phân tử RT PCR

ác định kiểu gen virus viêm gan c trong huyết thanh bệnh nhân viêm gan c bằng kỹ thuật sinh học phân tử RT PCR
... trình tự gen type 6h (Hình 3.8) 78 HCV GAGGTACTTGCCACATATTGCGGCTTTCCCTCCTTGGGCGATAAGTTTGGCCCTGACCGCTCGGGCTC GGTGTCTCCAAGCTCTCAAGGGAGGAGCCCCAAGTTTTCTGAGGCATGATGCCACCCGATTGAGTTCGCCG GGAGAGTACCCATGGAGTGAGAATGCGGCCATGCCGTGGAGTCTTTGAATGATCACTGGGAGATCAAGCG ... GGAGAGTACCCATGGAGTGAGAATGCGGCCATGCCGTGGAGTCTTTGAATGATCACTGGGAGATCAAGCG GAGTGATTGAATATGTGACTCCGTAGATATCGAAGTCAAGTGCCCTGTCCAAAGTCTCCTGTGCCTGGAGT ATTTGAAAGAAATGGGTCATGAGTACCATACGCACCCAAATGGTGGGGGCATACATAATGATGTTCCCTAA CCATGAATTCACAGGAGTGTGGCGAGCGGTCTCCCAGGCCGCCCTCGCCAGTGGAGTGACAGGGTCACGA ... pháp x c định genotype, chọn đề tài: “X c định kiểu gen virus viêm gan C huyết bệnh nhân viêm gan C kỹ thuật sinh h c phân tử RT- PCR , với m c tiêu sau : 1) X c định tỉ lệ người mang kiểu gen HCV...
  • 56
  • 240
  • 1

Xác định kiểu gen virus viêm gan C trong huyết thanh bệnh nhân viêm gan C bằng kỹ thuật sinh học phân tử RT-PCR

Xác định kiểu gen virus viêm gan C trong huyết thanh bệnh nhân viêm gan C bằng kỹ thuật sinh học phân tử RT-PCR
... trình tự gen type 6h (Hình 3.8) 78 HCV GAGGTACTTGCCACATATTGCGGCTTTCCCTCCTTGGGCGATAAGTTTGGCCCTGACCGCTCGGGCTC GGTGTCTCCAAGCTCTCAAGGGAGGAGCCCCAAGTTTTCTGAGGCATGATGCCACCCGATTGAGTTCGCCG GGAGAGTACCCATGGAGTGAGAATGCGGCCATGCCGTGGAGTCTTTGAATGATCACTGGGAGATCAAGCG ... GGAGAGTACCCATGGAGTGAGAATGCGGCCATGCCGTGGAGTCTTTGAATGATCACTGGGAGATCAAGCG GAGTGATTGAATATGTGACTCCGTAGATATCGAAGTCAAGTGCCCTGTCCAAAGTCTCCTGTGCCTGGAGT ATTTGAAAGAAATGGGTCATGAGTACCATACGCACCCAAATGGTGGGGGCATACATAATGATGTTCCCTAA CCATGAATTCACAGGAGTGTGGCGAGCGGTCTCCCAGGCCGCCCTCGCCAGTGGAGTGACAGGGTCACGA ... pháp x c định genotype, chọn đề tài: X c định kiểu gen virus viêm gan C huyết bệnh nhân viêm gan C kỹ thuật sinh h c phân tử RT-PCR , với m c tiêu sau : 1) X c định tỉ lệ người mang kiểu gen HCV...
  • 55
  • 34
  • 0

Tìm hiểu quy trình xét ngiệm viêm gan B bằng phương pháp ELISA

Tìm hiểu quy trình xét ngiệm viêm gan B bằng phương pháp ELISA
... sang b x gan,< /b> chai gan,< /b> thm cú th tin n ung th gan < /b> Bs: Hong Xuõn Th 12 Tỡm hiu quy < /b> trỡnh xột ngim viờm gan < /b> B bng phng phỏp ELISA Din tin ca bnh viờm gan < /b> siờu vi B ph thuc vo th trng ca tng bnh ... http://www.sumplediluents.htm Bs: Hong Xuõn Th 36 Tỡm hiu quy < /b> trỡnh xột ngim viờm gan < /b> B bng phng phỏp ELISA PH LC: Mỏy li tõm Bs: Hong Xuõn Th 37 Tỡm hiu quy < /b> trỡnh xột ngim viờm gan < /b> B bng phng phỏp ELISA Mỏy ELISA Bs: ... viờm gan < /b> B cp khang 100 000 ngi Tn sut ca HBsAg cú biờn t di 0.1% Bc u v t 5% Nam Chõu u Bs: Hong Xuõn Th Tỡm hiu quy < /b> trỡnh xột ngim viờm gan < /b> B bng phng phỏp ELISA Hỡnh : S dch t ca HBsAg...
  • 39
  • 381
  • 2

NGHIÊN cứu CHẾ tạo PANEL CHUẨN để ĐÁNH GIÁ CHẤT LƯỢNG SINH PHẨM CHẨN đoán VIÊM GAN c

NGHIÊN cứu CHẾ tạo PANEL CHUẨN để ĐÁNH GIÁ CHẤT LƯỢNG SINH PHẨM CHẨN đoán VIÊM GAN c
... thiết lập đ c panel anti-HCV chuẩn để phân loại chất lợng sinh phẩm chẩn đoán anti-HCV thơng mại C c mẫu huyt ca WHO ch to panel đ c thu thp t c c chõu lc Năm 2000, Hội đồng Qu c tế Panel chuẩn đa ... dụng panel chế tạo để đánh giá chất lợng cac sinh phẩm chẩn đoán anti-HCV B panel hon chnh gm panel kim tra nhy v panel kim tra c hiu: - Panel kim tra c hiu gm 25 mẫu huyết anti-HCV (-) c ký ... antiHCV ó c C quan qun lý thuc v thc phm M (FDA) cp giy chng nhn Ngoi ra, c c mu huyt ny u c sng lc HBsAg v anti-HIV i vi panel ca TCYTTG (WWHV301), c c mu huyt c thu thp t c c chõu lc Tt c c c mu...
  • 69
  • 354
  • 3

Tài liệu TIỂU LUẬN: CHẨN ĐOÁN CÚM GIA CẦM BẰNG KỸ THUẬT ELISA docx

Tài liệu TIỂU LUẬN: CHẨN ĐOÁN CÚM GIA CẦM BẰNG KỸ THUẬT ELISA docx
... 2.1.3.5 Chẩn đoán a .Chẩn đoán lâm sàng b .Chẩn đoán phòng thí nghiệm 2.1.3.6 Phòng chống bệnh cúm gia cầm Chương 3: CHẨN ĐOÁN CÚM GIA CẦM BẰNG KỸ THUẬT ELISA ... cúm gia cầm áp dụng nhằm hạn chế lây lan phát tán mầm bệnh Vì việc phát hiện, chẩn đoán virus cúm gia cầm cách có hiệu quả, nhanh, xác, rẻ tiền vấn đề thiết “ Chẩn đoán virus cúm gia cầm kỹ thuật ... gia cầm kỹ thuật ELISA kỹ thuật đáp ứng yêu cầu thực tiễn áp dụng rộng rãi Chẩn đoán virus cúm gia cầm ELISA TỔNG QUAN 2.1 BỆNH CÚM GIA CẦM 2.1.1 LỊCH SỬ BỆNH Bệnh cúm gia cầm bệnh truyền nhiễm...
  • 24
  • 310
  • 0

TIỂU LUẬN:CHẨN ĐOÁN VI KHUẨN LISTERIA BẰNG KỸ THUẬT GEN pptx

TIỂU LUẬN:CHẨN ĐOÁN VI KHUẨN LISTERIA BẰNG KỸ THUẬT GEN pptx
... Chẩn đoán vi khuẩn Listeria monocytogens kỹ thuật gene I ĐẶT VẤN ĐỀ Trong số sáu loại Listeria biết đến Listeria monocytogenes Listeria ivanovii tác nhân gây bệnh Nhưng Listeria ivanovii gây ... test ANTON gây vi m kết mạc mắt Một bệnh L.monocytogenes Phạm Ngọc Hà Chẩn đoán vi khuẩn Listeria monocytogens kỹ thuật gene Vi m màng não mủ, hay vi m màng não nhiễm khuẩn, tượng vi m màng bao ... loài Listeria monocytogenes L innocua L ivanovii L seeligeri L welshimeri L grayi II.2 Giới thiệu chung Listeria motocytogenes Phạm Ngọc Hà Chẩn đoán vi khuẩn Listeria monocytogens kỹ thuật gene...
  • 21
  • 192
  • 0

XÁC ĐỊNH KIỂU GEN CÁC ĐỘT BIẾN KHÁNG THUỐC CỦA SIÊU VI VIÊM GAN B BẰNG KỸ THUẬT GIẢI TRÌNH TỰ CHUỖI potx

XÁC ĐỊNH KIỂU GEN VÀ CÁC ĐỘT BIẾN KHÁNG THUỐC CỦA SIÊU VI VIÊM GAN B BẰNG KỸ THUẬT GIẢI TRÌNH TỰ CHUỖI potx
... kháng < /b> thuốc < /b> HBV xác < /b> định < /b> kiểu < /b> gen < /b> HBV Chúng sử dụng kỹ thuật giải trình tự chuỗi (Sequencing) để đồng thời vừa xác < /b> định < /b> đột < /b> biến < /b> kháng < /b> thuốc < /b> Lamivudine HBV vừa xác < /b> định < /b> kiểu < /b> gen < /b> HBV, khảo sát kiểu < /b> ... 83,3% Kết luận: Qua kết b ớc đầu đạt thấy kỹ thuật giải trình tự chuỗi giữ vai trò quan trọng vi< /b> c xác < /b> định < /b> kiểu < /b> gen < /b> siêu < /b> vi < /b> viêm < /b> gan < /b> B vi< /b> c nhận diện đột < /b> biến < /b> kháng < /b> thuốc < /b> Lamivudine để từ có ... b nh nhân kiểu < /b> gen < /b> B dễ phát triển đột < /b> biến < /b> kháng < /b> Lamivudine kiểu < /b> gen < /b> khác4, kiểu < /b> gen < /b> D có đột < /b> biến < /b> kháng < /b> Lamivudine cao kiểu < /b> gen < /b> A2 Kết ghi nhận (B ng 2) tỉ lệ có đột < /b> biến < /b> kháng < /b> Lamivudine kiểu...
  • 17
  • 200
  • 3

CHẨN ĐOÁN VI KHUẨN LISTERIA BẰNG KỸ THUẬT GEN pdf

CHẨN ĐOÁN VI KHUẨN LISTERIA BẰNG KỸ THUẬT GEN pdf
... nét Listeria II.2 Giới thiệu chung Listeria motocytogenes II.3 Chuẩn đoán Listeria monocytogenes kỹ thuật gene III Kết luận IV Tài liệu tham khảo I Đặt vấn đề  Trong số sáu loại Listeria, Listeria ... (III), (V), VII, IX (III), V, VI (III), V, VI, VII, IX (III), V, VII (III), VI, VIII (III), V, VI, VIII, IX) A, B, C A, B, C A, B, C A, B, C A, B, C A, B, C 16 Độc tố • Vi khuẩn sản sinh men hemolysinase ... Listeria monocytogenes kỹ thuật gene Dựa tên gene: gene DTH-18, gene listeriolysin O (hly A) iap 25 Phân lập L.monocytogenes từ phô mai • 25g phô mai đồng với 225ml dung dịch tăng sinh Listeria( LEB)-làm...
  • 41
  • 237
  • 4

xây dựng quy trình nhân giống cây đồng tiền bằng kỹ thuật nuôi cấy mô ppt

xây dựng quy trình nhân giống cây đồng tiền bằng kỹ thuật nuôi cấy mô ppt
... dụng cho 13 giống thí nghiệm cho kết t ơng tự Kết luận 3.1 Đã xây dựng đ ợc quy trình nhân giống hoa đồng tiền ph ơng pháp nuôi cấy hoàn chỉnh nh sau: Chế độ khử trùng thích hợp cho giai đoạn ... nuôi cấy nuôi cấy 16 tuần nuôi cấy (1,5ppm BA + 0,2 Sùi callus 10%, Sùi callus 9%, sau Sùi callus 7%, sau ppmK + sau - 10 tuần - 10 tuần nuôi Chết 10 tuần nuôi cấy 0,2ppmIAA) nuôi cấy cấy Sùi ... agar Môi tr ờng rễ tốt nhất: MS + 0,1ppm NAA + 2,5% sacaroza +6,5g agar/lít Thời vụ tốt vụ xuân, đồng tiền cấy vào vụ thu vụ đông Giá thể tốt cho đồng tiền cấy mùn+trấu hun (1:1) 4.2 Đây quy...
  • 6
  • 348
  • 8

ĐÁNH GIÁ CHẤT LƯỢNG bộ KIT NANOQUANT REAL TIME HBV TRONG VIỆC ĐỊNH LƯỢNG VIRUS VIÊM GAN b BẰNG kỹ THUẬT REAL TIME PCR

ĐÁNH GIÁ CHẤT LƯỢNG bộ KIT NANOQUANT REAL TIME HBV TRONG VIỆC ĐỊNH LƯỢNG VIRUS VIÊM GAN b BẰNG kỹ THUẬT REAL TIME PCR
... AmpliPrep/Cobas Taqman HBV < /b> định < /b> lợng HBV < /b> mà không b tính hiệu xác Kết luận Chúng xây dựng quy trình đánh < /b> giá < /b> tiêu chất < /b> lợng kit < /b> NanoQuant < /b> real-< /b> time < /b> HBV < /b> định < /b> lợng HBV < /b> B < /b> kit < /b> NanoQuant < /b> real-< /b> time < /b> HBV < /b> đạt đợc ... NanoQuant < /b> real-< /b> time < /b> HBV < /b> Cobas AmpliPrep/Cobas Taqman HBV < /b> Chúng so sánh định < /b> lợng HBV < /b> 97 mẫu huyết dơng tính HBV < /b> hai kit < /b> NanoQuant < /b> real-< /b> time < /b> HBV < /b> Cobas AmpliPrep/Cobas Taqman HBV < /b> Kết định < /b> lợng hai kit < /b> ... trình đánh < /b> giá < /b> chất < /b> lợng kit < /b> NanoQuant < /b> real-< /b> time < /b> HBV < /b> Quy trình đánh < /b> giá < /b> chất < /b> lợng kit < /b> HBV < /b> đợc xây dựng dựa hớng dẫn đánh < /b> giá < /b> chất < /b> lợng kit < /b> hành [5,6] Quy trình bao gồm việc < /b> đánh < /b> giá < /b> chất < /b> tiêu chất...
  • 4
  • 184
  • 0

Bước đầu phát triển bộ KIT chẩn đoán nhanh bệnh lao bằng kỹ thuật polymerase chain reaction

Bước đầu phát triển bộ KIT chẩn đoán nhanh bệnh lao bằng kỹ thuật polymerase chain reaction
... yếu làm cho người ta dễ mắc lao (http://wikipedia.org/wiki /Lao ỵ Do việc phát hiện, chẩn đoán sớm xác bệnh lao yêu cầu xúc xã hội Để phát triển kỹ thuật chẩn đoán bệnh lao điều tất yếu cần thiết ... xuất kit dùng để chẩn đoán bệnh lao kỹ thuật PCR vói xu hướng ngày PCR xem qui trình chuẩn góp phần việc phát vi khuẩn gây bệnh, vừa nhanh chóng, vừa xác kỹ thuật xét nghiệm thiếu cần chẩn đoán bệnh ... đề tài “ Bước đầu phát triển kỉt chẩn đoán nhanh bệnh lao kỹ thuật polymerase Chain reaction Mục tiêu đề tài: - Chọn cặp mồi (primers) thích hợp sử dụng hóa chất cần thiết để tạo nên kit hổ trợ...
  • 63
  • 165
  • 0

BÁO CÁO KHOA HỌC: "PHÁT HIỆN CÁC ĐỘT BIẾN HAEMOPHILIA A BẰNG KỸ THUẬT PCR-RFLP SỬ DỤNG DEEP VENT ADN POLYMERASE" pot

BÁO CÁO KHOA HỌC:
... kb) bao gồm 26 exon (1) Kỹ thuật PCR dùng Taq ADN polymerase, sau phát điểm đột biến enzyme giới hạn (PCR-RFLP) nghiên cứu trước sử dụng có hiệu để phát đột biến bệnh Haemophilia A( 1, 2) Deep Vent ... Vent ADN polymerase có hoạt tính xúc tác trình tổng hợp ADN Taq ADN polymerase Các nghiên cứu hãng New England Biolab cho thấy Deep Vent ADN polymerase có nhiều ưu điểm so với Taq ADN polymerase ... trình phát đột biến intron 18 19 gen mã hoá cho yếu tố VIII, bệnh Haemophilia A kỹ thuật PCR-RFLP với Deep Vent ADN polymerase • 8/19 (42%) số bệnh nhân Haemophilia A nghiên cứu có mang đột biến intron...
  • 16
  • 117
  • 0

Xem thêm

Từ khóa: xét nghiệm chẩn đoán viêm gan ctỉ lệ bệnh nhân chẩn đoán viêm gan c theo giới tínhtỉ lệ bệnh nhân chẩn đoán viêm gan c mạnchẩn đoán vi khuẩn listeria bằng kỹ thuật genquy trình chẩn đoánchẩn đoán viêm gan mạnquy trình xét nghiệm viêm gan bquy trình chẩn đoán laoquy trình chẩn đoán cộng đồngquy trình chẩn đoán bệnh cúm gia cầmchẩn đoán viêm gan siêu vi b cấptiêu chuẩn chẩn đoán viêm gan siêu vi b cấpxét nghiệm chẩn đoán viêm gan btổng quan quy trình chẩn đoán động cơxét nghiệm chẩn đoán viêm gan siêu vi bTIỂU LUẬN tư TƯỞNG hồ CHÍ MINH về CHỦ NGHĨA dân tộc, yêu nước TRONG tác PHẨM báo cáo bắc kỳ, TRUNG kỳ, NAM kỳBài Giảng Tuyển DụngBài Giảng Phân Tích Tài Chính Doanh NghiệpĐánh giá kết quả điều trị ung thư dạ dày giai đoạn IIB III (t4, n0 3, m0) bằng hóa chất bổ trợ EOX sau phẫu thuật tại bệnh viện k (TT)Chi Phí Sử Dụng Vốn Và Cơ Cấu Nguồn VốnQuản lý tổng hợp chất thải rắn trên địa bàn tp. Mỹ Tho, tỉnh Tiền GiangCách viết mở bàiBài Giảng Sơ Đồ Tư DuyBài Giảng Quản Trị Chiến LượcBài Giảng Hoạch Định Nhân SựLUẬN văn THẠC sĩ đào tạo, PHỔ cập CHUYÊN môn NGÀNH NGHỀ CHO NGƯỜI LAO ĐỘNG TRONG LĨNH vực NÔNG NGHIỆP ở nước TA HIỆN NAYBài Giảng Đánh Giá Chiến Lược Khu Vực CôngBài Giảng Quản Trị Dự ÁnBài Giảng Tổng Quan Về Quản Lý Dự ÁnBài Giảng Chức Năng Kiểm SoátTục Ngữ Trung QuốcBài 17. Nước Việt Nam Dân chủ Cộng hoà từ sau ngày 2-9-1945 đến trước ngày 19-12-1946 - Lịch sử 12Bài Thuyết Trình Sách Suy Nghĩ Và Làm GiàuHướng dẫn học sinh lớp 8 nắm vững bản chất vật lý khi giải các bài tập về áp suất chất lỏng tại trường THCS Chu Văn An Huyện Nga Sơnbáo cáo thiết kế luận lý số lab 1