Site selectivity in electrophilic aromatic substitution

Tài liệu Báo cáo khoa học: Disulfide bridge regulates ligand-binding site selectivity in liver bile acid-binding proteins ppt

Tài liệu Báo cáo khoa học: Disulfide bridge regulates ligand-binding site selectivity in liver bile acid-binding proteins ppt
... homologous liver zebrafish protein, where the introduction of a disulfide bridge resulted, intriguingly, in a singly ligated protein, with the cholate occupying the more superficial binding site [16] ... lead to distinct binding and functional properties [22,23] In line with this, we have shown here that the presence of a disulfide bridge, while maintaining the same binding stoichiometry, induces ... activation regulates ligand binding in chicken liver bile acid-binding protein J Biol Chem 281, 9697–9709 10 Eberini I, Guerini Rocco A, Ientile AR, Baptista AM, Gianazza E, Tomaselli S, Molinari...
  • 13
  • 233
  • 0

Tài liệu Báo cáo khoa học: Tryptophan tryptophylquinone cofactor biogenesis in the aromatic amine dehydrogenase of Alcaligenes faecalis Cofactor assembly and catalytic properties of recombinant enzyme expressed in Paracoccus denitrificans pptx

Tài liệu Báo cáo khoa học: Tryptophan tryptophylquinone cofactor biogenesis in the aromatic amine dehydrogenase of Alcaligenes faecalis Cofactor assembly and catalytic properties of recombinant enzyme expressed in Paracoccus denitrificans pptx
... performing detailed kinetic studies of both AADH enzymes, we show that the recombinant enzyme is indistinguishable from the native AADH of A faecalis and benzylamine is a substrate during steady-state ... tryptophan tryptophylquinone as the redox prosthetic group in methylamine dehydrogenase Science 252, 817–824 Chistoserdov AY (2001) Cloning, sequencing and mutagenesis of the genes for aromatic amine dehydrogenase ... Davidson VL & Wilmot CM (2004) Further insights into quinone cofactor biogenesis: probing the role of mauG in methylamine dehydrogenase tryptophan tryptophylquinone formation Biochemistry 43,...
  • 16
  • 228
  • 0

Tài liệu Báo cáo khoa học: Identification of critical active-site residues in angiotensin-converting enzyme-2 (ACE2) by site-directed mutagenesis docx

Tài liệu Báo cáo khoa học: Identification of critical active-site residues in angiotensin-converting enzyme-2 (ACE2) by site-directed mutagenesis docx
... inhibitor binding Subdomain I (N-terminal) contains the zinc-binding site, which faces into the deep cleft formed by the two subdomains connected at the base of the cleft The hinge-bending motion ... importance of key active-site residues of ACE2 through site-directed mutagenesis, with the aim of providing practical evidence for their role in substrate binding ⁄ hydrolysis In addition, the effect of ... to have a direct in uence on zinc binding (the zinc ˚ ion is separated from CL1 by 20.7 A in tACE and is coordinated by residues in subdomain I), it may be important for stabilizing complex formation...
  • 9
  • 183
  • 0

Tài liệu Báo cáo Y học: Structural determinants of the half-life and cleavage site preference in the autolytic inactivation of chymotrypsin pdf

Tài liệu Báo cáo Y học: Structural determinants of the half-life and cleavage site preference in the autolytic inactivation of chymotrypsin pdf
... D -chymotrypsin trypsin Phe114 !Ile-D -chymotrypsin Phe114 !Ile-D -chymotrypsin ( –Ca21) Phe114 !Ile-D -chymotrypsin trypsin Wild-type trypsin Mutant trypsin Mutant trypsin trypsin Mutant trypsin ... by analyzing the linearized time dependence curves Enzyme(s) Wild-type chymotrypsin D -Chymotrypsin D -Chymotrypsin ( –Ca21) D -Chymotrypsin trypsin Tyr146 !His/Asn147!Ser D -chymotrypsin Tyr146 !His/Asn147!Ser ... undesirable sites of chymotrypsin D-Chymotrypsinogen is a chimera constructed to contain a trypsinogen propeptide instead of the Cys1–Cys122-linked wild-type chymotrypsinogen peptide D-Chymotrypsinogen...
  • 9
  • 250
  • 0

Do Minimum Wages Really Reduce Teen Employment? Accounting for Heterogeneity and Selectivity in State Panel Data pptx

Do Minimum Wages Really Reduce Teen Employment? Accounting for Heterogeneity and Selectivity in State Panel Data pptx
... status categories Do Minimum Wages Really Reduce Teen Employment? / 217 a 25-quarter window, starting at eight quarters before the minimum wage change and continuing to sixteen quarters after ... refers to the log of the minimum wage; i, s, and t denote, respectively, individual, state, and time indexes; X is a vector of individual Do Minimum Wages Really Reduce Teen Employment? / 215 TABLE ... affect teen outcomes differentially in high versus low unemployment periods Do Minimum Wages Really Reduce Teen Employment? / 213 In the patchwork of minimum wage laws in the United States, indexation...
  • 36
  • 296
  • 0

Báo cáo khoa học: "Blocked Inference in Bayesian Tree Substitution Grammars" potx

Báo cáo khoa học:
... maximal init 100 200 300 400 500 iteration Figure 4: Training likelihood vs iteration Each sampling method was initialised with both minimal and maximal elementary trees Training Local minimal init ... for inference in infinite TSGs We also trained the model on the standard Penn treebank training set (sections 2–21) We initialised the model with the final sample from a run on the small training ... variables in the model To formulate the local sampler, we associate a binary variable with each non-root internal node of each tree in the training set, indicating whether that node is a substitution...
  • 6
  • 139
  • 0

Báo cáo Y học: The role of hydrophobic active-site residues in substrate specificity and acyl transfer activity of penicillin acylase pdf

Báo cáo Y học: The role of hydrophobic active-site residues in substrate specificity and acyl transfer activity of penicillin acylase pdf
... phenylalanine was therefore mutated to Ala, Leu, Trp or Tyr These mutations may in uence the shape and volume of the acyl binding pocket and thereby alter the binding mode and affinity of the enzyme ... PAA and derivatives thereof, while maintaining the hydrophobicity of the binding site To test the effect of the mutations on the specificity for phenylacetylated substrates, the steady-state kinetic ... the deacylation reaction in the active site of the acyl- enzyme have been changed by the bF24A mutation The rate-limiting step in the synthesis reaction is the acylation of the enzyme and it therefore...
  • 8
  • 206
  • 0

Báo cáo khoa học: Aegyptin displays high-affinity for the von Willebrand factor binding site (RGQOGVMGF) in collagen and inhibits carotid thrombus formation in vivo ppt

Báo cáo khoa học: Aegyptin displays high-affinity for the von Willebrand factor binding site (RGQOGVMGF) in collagen and inhibits carotid thrombus formation in vivo ppt
... the sequence involved in collagen interaction with vWF, and also interacts with GPVI and integrin a2b1 binding sites Aegyptin effectively inhibits carotid thrombus formation in vivo Results Aegyptin ... detectable for collagen (lower right panel) Aegyptin binds with high affinity to the vWF binding site in collagen, independently of hydroxyproline In an attempt to identify the binding sites involved in ... Mosquito collagen -binding protein A C Fig Aegyptin displays high affinity for the vWF binding site of collagen Sensorgrams show aegyptin binding to immobilized cross-linked RGQOGVMGF (A), linear...
  • 15
  • 194
  • 0

Báo cáo khoa học: The catalytic significance of the proposed active site residues in Plasmodium falciparum histoaspartic protease ppt

Báo cáo khoa học: The catalytic significance of the proposed active site residues in Plasmodium falciparum histoaspartic protease ppt
... interaction between the main chain oxygen of Ala216 and the e-amine of Lys78 In H34A mutant (Fig 6B), the interaction between the imidazole ring and Asp214 disappeared and the side chain of Asp214 is ... conserved in HAP [8] placing Lys78 in a position that can compensate for the loss of His34 which allows for the interaction with the lytic hydroxyl in the active site Interestingly, residue 78 in most ... molecular modeling, of three mutant HAP proteins, H34A, S37A and D214A, in an effort to identify the importance of residues proposed to be catalytically essential in HAP Catalytic residues in histoaspartic...
  • 10
  • 95
  • 0

Efficient site directed in vitro mutagenesis using ampicillin selection potx

Efficient site directed in vitro mutagenesis using ampicillin selection potx
... by propagating the plasmid in E coli NM522 and infecting with M13K07 helper phage In vitro mutagenesis to remove the Hind Im site was performed by hybridizing an oligonucleotide having the sequence ... tetracycline resistance gene and is initially propagated in a host in the presence of tetracycline The ampicillin resistance gene on the vector has been inactivated by cutting at the Pst I site, ... gene, we found we could generate many ampicillin resistant colonies starting from single-stranded DNA and following the in vitro fill in reaction outlined in Materials and Methods When the complement...
  • 5
  • 61
  • 0

Báo cáo Y học: Potential active-site residues in polyneuridine aldehyde esterase, a central enzyme of indole alkaloid biosynthesis, by modelling and site-directed mutagenesis ppt

Báo cáo Y học: Potential active-site residues in polyneuridine aldehyde esterase, a central enzyme of indole alkaloid biosynthesis, by modelling and site-directed mutagenesis ppt
... TGAGAAGTACAATGAGAAGTGTCCGGCAGATA TG-3¢ C17 0A: 5¢-GGCCCTCAAAATGTTCCAGAATT GCTCAGTCGAGGACCTTG-3¢ C-213S: 5¢-CGGTGA AGCGAGCTTATATCTTTTGCAATGAAGATAAAT CATTT-CC-3¢ C25 7A: 5¢GCCAAGGGAAGTTTGCA AGTGCCTGCTTGATATATCAGATT-CA-3¢ ... of polyneuridine aldehyde into epi-vellosimine This central reaction of the pathway is catalysed by the enzyme polyneuridine aldehyde esterase (PNAE) The QuikChangeTM in vitro Site-Directed Mutagenesis ... Germany) and diethylpyrocarbonate (DEPC) was from AppliChem (Darmstadt, Germany) All solvents and chemicals were of analytical grade and obtained from Merck (Darmstadt, Germany), Sigma (Deisenhofen,...
  • 8
  • 169
  • 0

báo cáo hóa học:" Can the surgical checklist reduce the risk of wrong site surgery in orthopaedics? - can the checklist help? Supporting evidence from analysis of a national patient incident reporting system" pptx

báo cáo hóa học:
... this article as: Panesar et al.: Can the surgical checklist reduce the risk of wrong site surgery in orthopaedics? - can the checklist help? Supporting evidence from analysis of a national patient ... Wrong- site surgery: can we prevent it? Adv Surg 2008, 42:1 3-3 1 30 National Patient Safety Agency: Patient Safety Incident Reports in the NHS: National Reporting and Learning System Data Summary ... protecting against error have failed; there is an accident waiting to happen [31] The capacity to defend against the potential for minor mishaps having a cumulative effect and escalating into more...
  • 7
  • 151
  • 0

báo cáo hóa học:" Can the surgical checklist reduce the risk of wrong site surgery in orthopaedics? - can the checklist help? Supporting evidence from analysis of a national patient incident reporting system" pdf

báo cáo hóa học:
... this article as: Panesar et al.: Can the surgical checklist reduce the risk of wrong site surgery in orthopaedics? - can the checklist help? Supporting evidence from analysis of a national patient ... Wrong- site surgery: can we prevent it? Adv Surg 2008, 42:1 3-3 1 30 National Patient Safety Agency: Patient Safety Incident Reports in the NHS: National Reporting and Learning System Data Summary ... protecting against error have failed; there is an accident waiting to happen [31] The capacity to defend against the potential for minor mishaps having a cumulative effect and escalating into more...
  • 7
  • 200
  • 0

Báo cáo lâm nghiệp: "Tree density and site quality influence on Pinus halepensis Mill. reproductive characteristics after large fires" pdf

Báo cáo lâm nghiệp:
... for tree density and three for site quality distributed along Eastern Spain 2.3 Measurement of reproductive characteristics Fertilized cones were counted and classified based on appareance and age ... p-value Cone type Density Site quality Cone type Density Site quality 0.85 0.36 < 0.01* 0.04* 0.08* < 0.01* Figure Seed germination (X axis: site; Y axis: percentage).White bar: mature cones; grey ... populations in Israel [24, 28], SE Spain [40] and Greece [12] In this study the average number of seeds per cone showed differences depending on site quality, tree density and cone type Better site quality...
  • 8
  • 185
  • 0

Báo cáo lâm nghiệp: "Site index in relation to edaphic variables in stone pine (Pinus pinea L.) stands in south west Spain" ppt

Báo cáo lâm nghiệp:
... in stone pine stands growing in sandy areas The pattern of variation with site index is analysed, in a qualitative way, using results from a contingency table approach and graphics obtained in ... selvicultura del piñonero (Pinus pinea L.) en la provincia de Ávila, Producción, Montes 37 (1994) 45–51 [54] Yagüe S., Producción y selvicultura del piñonero (Pinus pinea L.) en la provincia de Ávila, ... similarity index values for edaphic categories found to be related to site index in the contingency analysis Smaller values indicate a lower association Textural type E is associated to site index...
  • 12
  • 85
  • 0

Xem thêm

Từ khóa: inductive effects in aromatic substitutionmake my site appear in google searchcreate sharepoint site definition in visual studio 2010the nusa tenggara uplands indonesia multiple site lessons in conflict managementsetting web site titles in internet explorerconversion yield and selectivity in reactorsfelkin anh or cram chelate selectivity in the addition of hydride donors to carbonyl compounds with an o or n atom in the α positionepoxides in polycyclic aromatic hydrocarbon metabolism and carcinogenesismanaging sharepoint site content in bulk using powershell1specialization and selectivity in the inflammatory gene expression programsa web site used in television broadcasting capacity 2 ana web site analysis in the u s and the ukheavy metal pollution in soil and plants at bone char sitelist of one word substitution in english with meaninghow to design a site in dreamweaver cs6Phát triển nguồn nhân lực đáp ứng yêu cầu công nghiệp hóa, hiện đại hóa ở thành phố Việt Trì, tỉnh Phú Thọ (LV thạc sĩ)Tăng cường quản lý thuế thu nhập cá nhân trên địa bàn huyện Tam Dương Vĩnh Phúc (LV thạc sĩ)Hoạt động của văn phòng tỉnh Bolykhamxay nước cộng hòa dân chủ nhân dân Lào (LV thạc sĩ)Năng lực chủ chốt cán bộ chính quyền cấp xã ở huyện Hà Trung, tỉnh Thanh Hóa hiện nay (LV thạc sĩ)Văn hóa công sở tại các trường đào tạo, bồi dưỡng cán bộ, công chức thuộc các bộ (LV thạc sĩ)Tạo động lực làm việc cho giảng viên trường đại học kinh tế Nghệ An (LV thạc sĩ)Thực hiện văn hóa công sở tại bộ tài nguyên và môi trường, nước Cộng hòa dân chủ nhân dân Lào (LV thạc sĩ)DE CUONG QUAN LY HANH CHINH NHA NUOCSKKN: Một số kinh nghiệm trong tổ chức thực hiện Mô hình “Em yêu Biển đảo Việt Nam”skkn Giáo dục truyền thống và chăm lo cho học sinh nghèo thông qua Mô hình “Đội chúng em tình nguyện”1 số giải pháp nhằm hoàn thiện việc thực hiện cơ chế “một cửa” tại UBND huyện đông anhNghiên cứu tử vong do tai nạn lao động ghi nhận tại tỉnh lạng sơn giai đoạn 2011 2014Nghiên cứu tác dụng của từ trường nhân tạo đối với cải thiện tuần hoàn não và phục hồi chức năng thần kinh ở bệnh nhân tai biến nhồi máu não bán cầu (TT)Nghiên cứu hiệu quả điều trị tăng sinh lành tính tuyến tiền liệt bằng kỹ thuật laser phóng bên (FULL TEXT)Đề án tốt nghiệp cao cấp lý luận chính trị đổi mới và nâng cao chất lượng hệ thống chính trị ở cơ sở xã, phường, thị trấnky thuat phong chong chay no p1 6415Đề án tốt nghiệp cao cấp lý luận chính trị nâng cao năng lực tổ chức thực tiễn cho đội ngũ cán bộ cấp cơ sởhuawei instruction C80216h 06 023r1Guide to multi carrier CDMA2000 BTS3606 20050922 a 2 10Installation method of DDF for BSS equipment
Nạp tiền Tải lên
Đăng ký
Đăng nhập