Nghiên cứu sự lưu hành của virus lở mồm long móng ở trâu, bò tại tỉnh quảng ninh và hiệu lực của vaccine aftopor trong công tác phòng chống

Nghiên cứu một số đặc điểm dịch tễ xác định type vi rút gây bệnh lở mồm long móng trâu, tại tỉnh Lai Châu

Nghiên cứu một số đặc điểm dịch tễ và xác định type vi rút gây bệnh lở mồm long móng ở trâu, bò tại tỉnh Lai Châu
... Nghiên cứu số đặc điểm dịch tễ xác định type vi rút gây bệnh LMLM đàn trâu, tỉnh Lai Châu" Mục tiêu nghiên cứu đề tài Xác định phân bố type vi rút LMLM tỉnh Lai Châu, làm sở lựa chọn loại vắc ... tỉnh Lai Châu cung cấp, bổ sung hoàn thiện thêm thông tin dịch tễ học bệnh LMLM vi t Nam - Các kết nghiên cứu số đặc điểm dịch tễ học, xác định phân bố type vi rút LMLM gây bệnh trâu, tỉnh Lai ... chống bệnh LMLM cho gia súc Ý nghĩa khoa học đề tài - Luận văn công trình nghiên cứu đặc điểm dịch tễ xác định type vi rút gây bệnh LMLM đàn trâu, tỉnh Lai Châu - Các kết điều tra, nghiên cứu tỉnh...
  • 88
  • 137
  • 0

Nghiên cứu một số đặc điểm dịch tễ xác định type vi rút gây bệnh lở mồm long móng trâu, tại tỉnh lào cai

Nghiên cứu một số đặc điểm dịch tễ và xác định type vi rút gây bệnh lở mồm long móng ở trâu, bò tại tỉnh lào cai
... nghiên cứu đề tài: "Nghiên cứu số đặc điểm dịch tễ xác định type vi rút gây bệnh Lở mồm long móng trâu, tỉnh Lào Cai" Mục tiêu nghiên cứu đề tài Xác định phân bố type vi rút LMLM tỉnh Lào Cai, ... dịch tễ xác định type vi rút gây bệnh LMLM đàn trâu, tỉnh Lào Cai - Các kết nghiên cứu dịch tễ học, xác định phân bố type vi rút LMLM gây bệnh trâu, tỉnh Lào Cai sở khoa học, giúp quan quản ... Khẩu đề dịch (Trung Quốc), Lở mồm long móng (Vi t Nam) 1.1.2 Khái niệm bệnh Bệnh lở mồm long móng vi rút thuộc họ Piconarviridae gây nên bệnh truyền nhiễm cấp tính nguy hiểm Bệnh đặc điểm sốt,...
  • 98
  • 80
  • 0

Khảo sát một số đặc điểm dịch tễ bệnh lở mồm long móng trâu, tại lâm đồng từ năm 2004 2009 đánh giá hiệu quả sử dụng của vacxin

Khảo sát một số đặc điểm dịch tễ bệnh lở mồm long móng ở trâu, bò tại lâm đồng từ năm 2004 2009 và đánh giá hiệu quả sử dụng của vacxin
... LMLM trâu, Lâm ñ ng t năm 2004 2009 58 3.2.2 Hình thái, m c ñ d ch, năm d ch LMLM trâu t i Lâm ñ ng t 2004 ñ n 2009 62 3.2.3 T l hi n m c b nh LMLM c a trâu Lâm ñ ng t năm 2004- 2009 ... nh Lâm ñ ng 50 3.2 S lư ng ñàn gia súc nh ng năm g n ñ y 53 3.3 K t qu công tác ki m d ch t năm 2004- 2009 c a Lâm ñ ng 56 3.4 Di n bi n d ch LMLM trâu, Lâm ñ ng t năm 2004- 2009 58 3.5 H s năm ... ch hi u qu b nh L m m long móng, th c hi n ñ tài: “Kh o sát m t s ñ c ñi m d ch t b nh L m m long móng trâu, t i Lâm ñ ng t năm 2004 2009 ñánh giá hi u qu s d ng c a vacxin Ý nghĩa khoa...
  • 104
  • 458
  • 7

SỰ LƯU HÀNH CỦA VIRUS LỞ MỒM LONG MÓNG (FMDV) TRÊN HEO TẠI TỈNH ĐỒNG THÁP pptx

SỰ LƯU HÀNH CỦA VIRUS LỞ MỒM LONG MÓNG (FMDV) TRÊN HEO TẠI TỈNH ĐỒNG THÁP pptx
... điểm nghiên cứu: huyện Tam Nông, thành phố Cao Lãnh huyện Châu Thành, tỉnh Đồng Tháp Nội dung nghiên cứu: Mẫu huyết heo chưa tiêm phòng vaccine lở mồm long móng (LMLM) huyện lấy ngẫu nhiên, huyện ... Đồng sông Cửu Long hàng năm bệnh LMLM xảy rải rác số nơi, tỉnh Đồng Tháp từ năm 2008 đến có ca bệnh xảy rải rác (CCTY Đồng Tháp, 2008, 2009, 2010) Chúng thực đề tài “Tình hình bệnh LMLM heo tỉnh ... (Bộ NN&PTNT, 2005) Năm 2005, phát bệnh xảy heo tỉnh Lào Cai, Khánh Hòa, virus type Asia gây Năm 2006 năm bệnh lở mồm long móng xảy mạnh hầu hết tỉnh thành Việt Nam với hàng chục nghìn gia súc...
  • 4
  • 135
  • 0

Một số đặc điểm dịch tễ bệnh lở mồm long móng trâu, lợn tại nghệ an từ năm 2002 2007, các giải pháp phòng chống bệnh

Một số đặc điểm dịch tễ bệnh lở mồm long móng ở trâu, bò và lợn tại nghệ an từ năm 2002 2007, các giải pháp phòng chống bệnh
... năm 2002- 2007 52 B ng 3.4 Di n bi n d ch LMLM 55 Ngh An t 2002- 2007 B ng 3.5 Ph m vi d ch LMLM t 2002- 2007 57 B ng 3.6 H s năm d ch c a trâu t ng năm giai ño n 2002- 2007 60 B ng 3.7 H sô năm ... An ñ góp ph n chương trình kh ng ch ñi ñ n toán b nh LMLM gia súc c a c nư c, th c hi n ñ tài: “ M t s ñ c ñi m d ch t b nh L m m long móng trâu l n t i Ngh An t năm 2002- 2007, gi i pháp phòng ... QUAN TÀI LI U 1.1 L CH S B NH L M M LONG MÓNG 1.1.1 ð nh nghĩa B nh l m m long móng (LMLM) b nh truy n nhi m c p tính lây lan r t nhanh, r t m nh, r t r ng c a loài móng gu c ch ñôi trâu, bò, ...
  • 105
  • 395
  • 9

nghiên cứu sự lưu hành của virus đậu dê, cừu trên đàn dê, cừu nuôi tại một số tỉnh nam trung bộ

nghiên cứu sự lưu hành của virus đậu dê, cừu trên đàn dê, cừu nuôi tại một số tỉnh nam trung bộ
... tình hình thực tế đặt vấn đề nghiên cứu: Nghiên cứu lưu hành virus đậu dê, cừu đàn dê, cừu nuôi số tỉnh Nam Trung bộ Với mục đích: giám sát lưu hành virus đậu dê, cừu làm sở khoa học để đề biện ... pháp phòng chống dịch bệnh đậu dê, cừu đạt hiệu Nội dung đề tài:  Điều tra tình hình dịch bệnh đậu dê, cừu số tỉnh Nam Trung  Xác định tỉ lệ nhiễm virus đậu dê, cừu mẫu bệnh phẩm thu thập CHƯƠNG ... lại virus đậu cừu protein dạng Kelch virus đậu dê Những số liệu so sánh gen mối quan hệ gần gũi loại virus thuộc nhóm Capripoxvirus chúng đoán virus đậu cừu virus đậu dê tiến hoá từ dạng virus...
  • 66
  • 261
  • 3

nghiên cứu sự lưu hành của virus cúm trên đàn gia cầm đáp ứng miễn dịch của gia cầm đối với vaccine h5n1 tại tỉnh quảng ninh

nghiên cứu sự lưu hành của virus cúm trên đàn gia cầm và đáp ứng miễn dịch của gia cầm đối với vaccine h5n1 tại tỉnh quảng ninh
... dch vi n gia cm cng khỏc Vỡ vy, nghiờn cu kh nng ỏp ng dch ca gia cm vi vaccine H5N1 ngoi thc a ti Qung Ninh bit hiu qu phũng bnh ca vaccine, t l bo h v di dch ca gia cm, t ú xỏc nh thi gian tiờm ... ca vaccine ny l khụng phõn bit gia cm c tiờm chng vi gia cm nhim virus thc a qua kim tra khỏng th Vaccine vụ hot d chng: Vaccine ny c sn xut tng t nh vaccine vụ hot ng chng im khỏc bit l chng virus ... hin l vaccine Trovac-AIVH5, vaccine cht chng H5 (Trung Quc), vaccine H5N1 (Trung Quc), vaccine H5N9 (Trung Quc) i vi g, vt: G ngy tui s dng vaccine Trovac-AIVH5 nh mt, mi Vaccine cht chng H5N1...
  • 96
  • 230
  • 1

Nghiên cứu sự lưu hành của vi rút lở mồm long móng trên trâu, hiệu lực của vắc xin trong công tác phòng dịch lở mồm long móng tại tỉnh Quảng Ninh

Nghiên cứu sự lưu hành của vi rút lở mồm long móng trên trâu, bò và hiệu lực của vắc xin trong công tác phòng dịch lở mồm long móng tại tỉnh Quảng Ninh
... Lở mồm long móng trâu, hiệu lực vắc xin công tác phòng dịch Lở mồm long móng tỉnh Quảng Ninh * Mục tiêu đề tài: - Nghiên cứu lưu hành vi rút LMLM đàn trâu, tỉnh Quảng Ninh - Nghiên cứu khả ... bàn tỉnh Quảng Ninh 57 3.3.1 Sự lưu hành vi rút LMLM tự nhiên đàn trâu Quảng Ninh 57 3.3.2 Định type vi rút LMLM trâu địa bàn tỉnh Quảng Ninh 61 3.3.2.1 Định type vi rút LMLM trâu ... độc lực vi rút 2°C vài tháng, sấy khô vi rút nhiệt để làm vắc xin Năm 1926, Vallée Carré nghiên cứu tác động Formol vi rút từ biểu bì cảm nhiễm, xử lý tạo thành vắc xin Formol công nhận có hiệu...
  • 96
  • 208
  • 2

Nghiên cứu sự lưu hành của một số virus gây bệnh cho người trên dơi Việt Nam

Nghiên cứu sự lưu hành của một số virus gây bệnh cho người trên dơi ở Việt Nam
... NGUYỄN THỊ THU THỦY NGHIÊN CỨU SỰ LƢU HÀNH CỦA MỘT SỐ VIRUS GÂY BỆNH CHO NGƢỜI TRÊN DƠI VIỆT NAM CHUYÊN NGÀNH MÃ SỐ : VI SINH VẬT HỌC : 62 42 40 01 LUẬN ÁN TIẾN SĨ SINH HỌC Người hướng dẫn khoa ... hƣơng số 18 loài linh trƣởng [29,34] Sự liên quan SARS-CoV; virus Dại gây bệnh cho ngƣời virus Corona; virus gây bệnh dại số loài dơi đặc trƣng cho thấy có đồng tiến hóa số loại virus vật chủ dơi ... họ dơi Việt Nam, loài dơi phân bố chủ yếu khu vực miền núi phía Bắc [13] Virus gây bệnh cho ngƣời tìm thấy nhóm dơi chủ yếu virus Lyssa bao gồm số genotype: virus dại (rabbies virus) , virus dơi...
  • 151
  • 122
  • 0

NGHIÊN CỨU SỰ LƯU HÀNH CỦA VIRUS CÚM B TẠI MIỀN BẮC VIỆT NAM

NGHIÊN CỨU SỰ LƯU HÀNH CỦA VIRUS CÚM B TẠI MIỀN BẮC VIỆT NAM
... lờn ca virus < /b> cỳm B 1.2 S LU HNH CA VIRUS < /b> CM B TRấN TH GII 10 1.3 S LU HNH CA VIRUS < /b> CM B TI VIT NAM 12 1.4 S TIN HểA CA VIRUS < /b> CM B 13 1.5 BIU HIN LM SNG V SINH BNH HC BNH CM 14 1.5.1 Biu hin ... QU V BN LUN.. 36 3.1 KT QU PHN LP V KHUCH I CC CHNG VIRUS < /b> CM B TI MIN BC VIT NAM, 2010-2012. 3.1.1 S lu hnh ca virus < /b> cỳm B ti Bc Vit Nam, 2010-2012 36 36 3.1.2 Kt qu phõn lp virus < /b> cỳm B ti Bc ... A/H3N2 B/ Florida/4/2006 (B/ Yamagata lineage) hoc B/ Florida/4/2006 (B/ Yamagata lineage) hoc B/ Wisconsin/01/2010 (B/ Yamagata lineage) B/ Wisconsin/01/2010 (B/ Yamagata lineage) B/ Brisbane/60/2008 ( B/ Victoria...
  • 100
  • 32
  • 0

NGHIÊN cứu sự lưu HÀNH của VIRUS cúm b tại MIỀN bắc VIỆT NAM

NGHIÊN cứu sự lưu HÀNH của VIRUS cúm b tại MIỀN bắc VIỆT NAM
... lờn ca virus < /b> cỳm B 1.2 S LU HNH CA VIRUS < /b> CM B TRấN TH GII 10 1.3 S LU HNH CA VIRUS < /b> CM B TI VIT NAM 12 1.4 S TIN HểA CA VIRUS < /b> CM B 13 1.5 BIU HIN LM SNG V SINH BNH HC BNH CM 14 1.5.1 Biu hin ... QU V BN LUN.. 36 3.1 KT QU PHN LP V KHUCH I CC CHNG VIRUS < /b> CM B TI MIN BC VIT NAM, 2010-2012. 3.1.1 S lu hnh ca virus < /b> cỳm B ti Bc Vit Nam, 2010-2012 36 36 3.1.2 Kt qu phõn lp virus < /b> cỳm B ti Bc ... A/H3N2 B/ Florida/4/2006 (B/ Yamagata lineage) hoc B/ Florida/4/2006 (B/ Yamagata lineage) hoc B/ Wisconsin/01/2010 (B/ Yamagata lineage) B/ Brisbane/60/2008 ( B/ Victoria lineage) B/ Wisconsin/01/2010 (B/ Yamagata...
  • 100
  • 46
  • 0

Nghiên cứu sự lưu hành của gene netb các chủng clostridium perfringens type a gây bệnh viêm ruột hoại tử gà nuôi tại thành phố nha trang

Nghiên cứu sự lưu hành của gene netb ở các chủng clostridium perfringens type a gây bệnh viêm ruột hoại tử ở gà nuôi tại thành phố nha trang
... Linh 31 5’ GGAGATGGTTGGATATTAGG 3’ 3’ GGACCAGCAGTTGTAGATA 5’ Cpb2-F 5’AGATTTTAAATATGATCCTAACC 3’ Cpb2-R Cpb2 Cpe-F Cpe-R Cpe 3’ CATACCCTTCACCAAATACTC 5’ 233 567 - Các thành phần tham gia phản ứng ... tử nuôi thành phố Nha Trang lưu hành gene netB chủng vi khuẩn C perfringens phân lập từ mắc bệnh Phát lưu hành gene mã h a độc tố netB chủng Clostridium perfringens gây bệnh viêm ruột hoại ... đ a bàn thành phố Nha Trang Để xác định mức độ nhiễm vi khuẩn C perfringens thành phố Nha Trang, tiến hành lấy mẫu đ a bàn nội thành, thành phố Nha Trang Tổng cộng lấy 38 mẫu phân bao...
  • 57
  • 203
  • 2

nghiên cứu sự lưu hành của salmonella typhimurium salmonella enteritidis trên đàn vịt tại hai tỉnh bắc ninh, bắc giang biện pháp phòng chống

nghiên cứu sự lưu hành của salmonella typhimurium và salmonella enteritidis trên đàn vịt tại hai tỉnh bắc ninh, bắc giang và biện pháp phòng chống
... nghiên cứu tiến hành nghiên cứu đề tài: Nghiên cứu lưu hành Salmonella typhimurium Salmonella enteritidis đàn vịt hai tỉnh Bắc Ninh, Bắc Giang biện pháp phòng chống Số hóa Trung tâm Học liệu - Đại ... dính của chủng Salmonella phân lập Đề xuất biện pháp phòng chống thích hợp Ý nghĩa khoa học thực tiễn đề tài Đây công trình nghiên cứu tập trung loài Salmonella đàn vịt hai tỉnh Bắc Ninh, Bắc Giang ... tiêu nghiên cứu đề tài Đánh giá lưu hành, đặc tính sinh vật, hoá học đặc tính gây bệnh vi khuẩn S typhimurium S enteritidis vịt hai tỉnh Bắc Ninh, Bắc Giang Xác định số yếu tố gây bệnh vi khuẩn Salmonella...
  • 111
  • 178
  • 2

nghiên cứu sự lưu hành của vi khuẩn pasteurella multocida trong bệnh tụ huyết trùng trâu, tại một số huyện có dịch trên địa bàn tỉnh hà giang biện pháp phòng trị

nghiên cứu sự lưu hành của vi khuẩn pasteurella multocida trong bệnh tụ huyết trùng ở trâu, bò tại một số huyện có dịch trên địa bàn tỉnh hà giang và biện pháp phòng trị
... NÔNG LÂM NGUYỄN THỊ HÀ NGHIÊN CỨU SỰ LƢU HÀNH CỦA VI KHUẨN PASTEURELLA MULTOCIDA TRONG BỆNH TỤ HUYẾT TRÙNG TRÂU, BÕ TẠI MỘT SỐ HUYỆN CÓ DỊCH TRÊN ĐỊA BÀN TỈNH HÀ GIANG VÀ BIỆN PHÁP PHÕNG TRỊ ... điểm dịch tễ bệnh tụ huyết trùng trâu, địa bàn tỉnh Giang - Nghiên cứu vai trò yếu tố khí hậu tác động đến đặc điểm dịch tễ bệnh tụ huyết trùng trâu, - Xác định lưu hành vi khuẩn Pasteurella ... nghành chăn nuôi Xuất phát từ yêu cầu thực tiễn, sở kế thừa kết nghiên cứu tác giả trước nước, tiến hành nghiên cứu đề tài: "Nghiên cứu lưu hành vi khuẩn Pasteurella multocida bệnh tụ huyết trùng...
  • 104
  • 288
  • 2

Xem thêm

Từ khóa: bệnh lở mồm long móng ở trâu bònghiệm chữa lở mồm long móng ở trâu bò bằng thuốc namgiảm kinh tế và những công cụ của nhà nước trong công tác phòng chống suy giảm kinh tếnghiên cứu chế tạo bộ kit rtpcr để chuẩn đoán virus lở mồm long móng lmlm đại diện đang lưu hành ở việt namnghiên cứu một số đặc tính sinh học của virus lở mồm long móng type o phân lập ở lợn tạinghiên cứu một số đặc điểm dịch tễ học đánh giá thiệt hại và đề xuất biện pháp phòng bệnh lở mồm long móng trên đàn bò nuôi tại tỉnh đăk lăktiểu luận chẩn đoán phòng thí nghiệm virus lở mồm long mónggiai đoạn 1 2 6 7 8 rất phổ biến trong thực phẩm bởi cơ chế gây bệnh nhanh chóng nhanh chóng bùng phát thành dịch gây bệnh trên diện rộng có thể kể đến rotavirus virus cúm virus lở mồm long móngthảo luận về sự tham gia của trẻ em trong hoạt động phòng chống thiên tai thanh hoásự chỉ đạo của chính quyền trong công tác đào tạo nghề cho lao động nông thôn huyệnphòng và điều trị bệnh lở mồm long móng ở dêlở mồm long móng ở lợnvai trò của cơ quan thanh tra nhà nước trong công tác phòng chống tham nhũngtrach nhiem cua hoc sinh trong cong tac phong khong nhan danvai trò của hệ thống chính trị cấp cơ sở trong công tác phòng chống tham nhũng ở bình thuận hiện naySổ Kế Toán Hình Thức Kế ToánBài Giảng Tổ Chức Công Tác Kế ToánBài Giảng Thị Trường Chứng Khoánbai 1 dap an ly thuyet va bai tap trong tam ve ankan va xicloankannhững đứa trẻOn dich thuoc laquan hệ từSap xep va loc du lieu tiet 2sự đông đặc và sự nỏng chảykiều ở lầu ngưng bíchlàm thơ lục bátmáy tính và phần mềm máy tínhBÌA 3 hàm số bậc hai pptgiun đấthàm điều kiện ìchuyện cũ trong phủ chúa trịnhcông nghệ genBài Giảng Bản Chất Và Đối Tượng Hạch Toán Kế ToánBài Giảng Bằng Chứng Kiểm Toáncô bé bán diêm 1