Hexane extract of raphanus sativus l roots inhibits

báo cáo khoa học: "Proteomic characterization of iron deficiency responses in Cucumis sativus L. roots" pot

báo cáo khoa học:
... localization of phosphoenolpyruvate carboxylase in developing and germinating wheat grains Plant Physiol 1998, 116:1249-1258 52 Neuhoff V, Arold N, Taube D, Ehrhardt W: Improved staining of proteins in ... Figure reports the changes in the relative spot volumes of proteins that were increased in quantity under Fe deficiency For most of the proteins there was an increasing trend between the th and ... of the protein with the increase/decrease being evaluated in a single date after one week of treatment The third paper [31] reports changes in the proteomic profiles of sugar beet root tips in...
  • 15
  • 65
  • 0

Bước đầu nghiên cứu, đánh giá một số chỉ tiêu chất lượng của rau mầm cải củ trắng (Raphanus Sativus L.) sản xuất trên giá thể sinh học

Bước đầu nghiên cứu, đánh giá một số chỉ tiêu chất lượng của rau mầm cải củ trắng (Raphanus Sativus L.) sản xuất trên giá thể sinh học
... cứu, đánh giá số tiêu chất lượng rau mầm cải củ trắng (Raphanus sativus L ) sản xuất giá thể sinh học 1.2 Mục tiêu đề tài Phân tích số tiêu chất lượng dinh dưỡng VSAT thực phẩm rau mầm cải củ trắng ... thời gian thu hoạch đến số tiêu chất lượng dinh dưỡng rau mầm cải củ trắng sản xuất giá thể SH - Đánh giá số tiêu vệ sinh an toàn thực phẩm rau mầm cải củ trắng sản xuất giá thể SH - Xác định thời ... chuộng rau mầm cải củ trắng - Đến chưa có nhiều công trình nghiên cứu chất lượng dinh dưỡng VSAT thực phẩm rau mầm nói chung chất lượng rau mầm cải củ trắng nói riêng Đề tài: Bước đầu nghiên cứu,...
  • 32
  • 684
  • 0

sử dụng phân hữu cơ bùn cống sinh hoạt trồng rau cải củ (raphanus sativus l )

sử dụng phân hữu cơ bùn cống sinh hoạt trồng rau cải củ (raphanus sativus l )
... tài: Sử dụng phân hữu bùn cống sinh hoạt trồng rau cải củ (Raphanus sativus L. ) thực với mục tiêu: Mục tiêu tổng quát: Đánh giá ảnh hưởng phân bón hữu bùn cống sinh hoạt đến suất rau cải củ nhằm ... Supe l n + 0,02 kg KCl) (12,95±2,10 - 14,28±2,1 8) Như thấy phân hữu bùn cống sinh hoạt giúp rau cải củ tăng trưởng tốt số nghiệm thức có sử dụng phân hữu bùn cống sinh hoạt NT2 (2,4 kg phân hữu bùn ... kg Supe l n + 0,02 kg KCl 24 CHƯƠNG KẾT LUẬN VÀ ĐỀ XUẤT 5.1 Kết luận Sử dụng phân hữu bùn cống sinh hoạt trồng rau cải củ (Raphanus sativus L. ) tiết giảm 75% phân hóa học, suất rau cải củ tương...
  • 57
  • 41
  • 0

Báo cáo khoa học: Purification and characterization of cathepsin B-like cysteine protease from cotyledons of daikon radish, Raphanus sativus docx

Báo cáo khoa học: Purification and characterization of cathepsin B-like cysteine protease from cotyledons of daikon radish, Raphanus sativus docx
... BSA as a standard [40] Purification of cathepsin B-like cysteine protease from daikon radish All purification procedures were performed at °C unless otherwise indicated Cotyledons of daikon radish ... specificity and sensitivity to protease inhibitors This article represents the first report detailing the enzymatic characterization of a plant CBCP Results Purification of cysteine protease from the cotyledons ... sprouts of daikon radish (R sativus) grown by hydroponics were purchased from a grocery store and used for purification of the enzyme For analysis of expression of the enzyme during germination, daikon...
  • 15
  • 104
  • 0

Báo cáo Y học: The DNA-polymerase inhibiting activity of poly(b-L-malic acid) in nuclear extract during the cell cycle of Physarum polycephalum pot

Báo cáo Y học: The DNA-polymerase inhibiting activity of poly(b-L-malic acid) in nuclear extract during the cell cycle of Physarum polycephalum pot
... except of DNA polymerase b-like, are inhibited by PMLA contained in the extracts The inhibitory activity during the cell cycle The inhibitory activity during the cell cycle was measured in the presence ... mitosis Thus, the in vivo and in vitro activities of DNA synthesis corresponded with the minimum of the inhibitory activity in the cell cycle The activity of DNA polymerases in the nuclear extracts ... activity in the cell cycle The in vivo activity of DNA polymerases The cell cycle dependence of DNA polymerase activity was followed under in vivo conditions The incorporation of radioactivity into...
  • 6
  • 142
  • 0

báo cáo khoa học: " Involvement of S-adenosylmethionine-dependent halide/thiol methyltransferase (HTMT) in methyl halide emissions from agricultural plants: isolation and characterization of an HTMT-coding gene from Raphanus sativus (daikon radish)" ppt

báo cáo khoa học:
... Figure analysis of methyl halides, methanethiol, and DMS from R sativus GC-MS GC-MS analysis of methyl halides, methanethiol, and DMS from R sativus (a) GC-MS spectrum of methyl halide standards ... the emission profiles of methyl halides from some plants and the characterization of the enzymatic properties of recombinant R sativus HTMT (RsHTMT) Results and discussion Wuosmaa and Hager [14] ... substrate for HTMT in A thaliana Cloning and sequence analysis of an HTMT coding gene from R sativus To investigate the properties of HTMT in R sativus, a full length HTMT-encoding gene (Rshtmt) was...
  • 10
  • 61
  • 0

Nghiên cứu nguồn vật liệu khởi đầu cho chọn tạo giống dưa chuột(cucumis sativus l ) ưu thế lai phục vụ chế biến

Nghiên cứu nguồn vật liệu khởi đầu cho chọn tạo giống dưa chuột(cucumis sativus l ) ưu thế lai phục vụ chế biến
... melo L. ); loài Citrullus có dưa h u (Citrullus lanatus Thunb); loài Lagenaria có b u (L siceraria M .), Sechium có su su dưa tr i (Trichosanthes anguina L. ) Theo Tatlioglu (199 3) [109], chi Cucumis ... 196 2) Trong ñó, loài quan tr ng nh t Cucurbita g m bí bí ngô (C maxima Duch, C moschata Duch Ex Lam .) Trong loài Cucumis bao g m dưa chu t (C sativus L. ), dưa l ho c dưa thơm (C melo L. ); loài ... T o gi ng ưu th lai dưa chu t 1.3.1 Cơ s di truy n c a hi n tư ng ưu th lai Ưu th lai (heterosis) hi n tư ng lai có s c s ng m nh b m , ho c c th lai, ho c t ng quan b ph n c a lai sinh trư ng,...
  • 201
  • 542
  • 2

Nghiên cứu một số biện pháp kỹ thuật thâm canh dưa chuột bản địa(cucumis sativus l ) tại huyện thuận châu,tỉnh sơn la

Nghiên cứu một số biện pháp kỹ thuật thâm canh dưa chuột bản địa(cucumis sativus l ) tại huyện thuận châu,tỉnh sơn la
... 198 5) [12] Ssp Himalaicus Fil - Nhóm ph Hymalaia Ssp Hernaphroditus Fil - Nhóm l ng tính Nhà ch n gi ng dưa chu t n i ti ng Tkachenco N (196 7) [55] ñã chia C sativus thành th (varieties) Var Vulgaris ... 4. 2) Vi c nghiên c u bi n pháp k thu t thâm canh dưa Mèo t i Thu n Châu, Sơn La vi c l m c n thi t giúp ngư i dân chuy n ñ i phương th c canh tác truy n th ng sang canh tác hàng hóa t p trung, thâm ... + 5,5 l Wehg) th p nh t 12,57 t n/ha (35 kg N) [9] 2.4 Sơ l c v tình hình s n xu t dưa chu t b n ñ a (dưa Mèo) t i huy n Thu n Châu, t nh Sơn La Gi ng dưa chu t b n ñ a (dưa Mèo) ñư c ñ ng bào...
  • 145
  • 354
  • 2

Khảo sát đặc tính nông sinh học của các dòng dưa chuột (cucumis sativus l ) địa phương tự phối đời i1 trồng tại gia lâm hà nội

Khảo sát đặc tính nông sinh học của các dòng dưa chuột (cucumis sativus l ) địa phương tự phối đời i1 trồng tại gia lâm   hà nội
... (parthenocarpy) Kubicki, 1964 [33] ñ nh hư ng vi c s d ng dòng l ng tính ñ trì dòng ñơn tính tham gia t h p lai ba D ng l ng tính ñ c (Andromonoecious): Trên có hoa ñ c hoa l ng tính D ng l ng tính ... Hermaphroditus Fil.- Dưa chu t l ng tính Nhà ch n gi ng dưa chu t n i ti ng Tkachenco N [50] ñã chia C sativus thành th (varieties): Var Vulgaris- dưa chu t thư ng Var Hernaphroditus- dưa chu t l ng tính ... t lai ( K.S Delaplane et al, 200 1) [35] H u h t gi ng d ng có ngu n g c Lan (Marinda) m t s gi ng qu nh có ngu n g c Châu Âu (Natufusinari) D ng l ng tính: Nghĩa ch có hoa l ng tính Hoa l ...
  • 115
  • 454
  • 5

Hình thái giải phẫu so sánh các loài mướp ta (luffa cylindrica (l ) roem), dưa chuột (cucumis sativus l ), dưa hấu (citrullus latanus mats et nakai), dưa gang (citrullus melo l )

Hình thái giải phẫu so sánh các loài mướp ta (luffa cylindrica (l ) roem), dưa chuột (cucumis sativus l ), dưa hấu (citrullus latanus mats et nakai), dưa gang (citrullus melo l )
... cylindrica (L) .Roen, Da chuột (Cucumis sativus L .), Da hấu( Citrullus latanus Mats et Nakai), Da gang( Cucumis melo L .) II Mục tiêu đề tài - Tìm hiểu đặc điểm hình thái, cấu tạo giải phẫu giống khác loài ... hấu (Citrullus latanus Mats et Nakai) 3.1 Đặc điểm hình thái 30 3.2 Đặc điểm giải phẫu 30 31 II Cây da gang (Cucumis melo L .) 4.1 Đặc điểm hình thái da hấu 38 4.2 Đặc điểm giải phẫu 38 III Các ... (Luffa cylindrica (L) .Roen) 15 1.1 Đặc điểm hình thái 15 1.2 Đặc điểm giải phẫu 15 16 II.2 Cây da chuột (Cucumisativus L .) 2.1 Đặc điểm hình thái 23 2.2 Đặc điểm giải phẫu 23 23 II.3 Cây da hấu...
  • 49
  • 363
  • 2

Khảo nghiệm một số giống dưa chuột (cucumis sativus l ) trong vụ xuân 2012 tại huyện tuy phước bình định

Khảo nghiệm một số giống dưa chuột (cucumis sativus l ) trong vụ xuân 2012 tại huyện tuy phước   bình định
... KHOA NÔNG L M NGƯ  - KHẢO NGHIỆM MỘT SỐ GIỐNG DƯA CHUỘT (Cucumis sativus L. ) TRONG VỤ XUÂN 2012 TẠI HUYỆN TUY PHƯỚC-BÌNH ĐỊNH KHÓA LUẬN TỐT NGHIỆP KỸ SƯ NGÀNH NÔNG HỌC Người thực : L p : ... đề tài: ‘ Khảo nghiệm số giống dưa chuột (Cucumis sativus L. ) vụ Xuân năm 2012 Bình Định ’ Mục đích - yêu cầu 2.1 Mục đích Tuy n chọn giống dưa chuột thích hợp vụ Xuân cho suất cao, ổn định, khả ... khả sinh trưởng, giống dưa chuột vụ Xuân 2012 - Đánh giá yếu tố cấu thành suất suất giống dưa chuột vụ Xuân 2012 - Đánh giá khả chống chịu sâu bệnh hại giống dưa chuột vụ Xuân 2012 2.2 Phạm vi...
  • 89
  • 791
  • 3

Báo cáo khoa học: Crystal structure of salt-tolerant glutaminase from Micrococcus luteus K-3 in the presence and absence of its product L-glutamate and its activator Tris pdf

Báo cáo khoa học: Crystal structure of salt-tolerant glutaminase from Micrococcus luteus K-3 in the presence and absence of its product L-glutamate and its activator Tris pdf
... report the crystal structure of the intact glutaminase under four different conditions: in the absence of the additives (referred to as N); in the presence of Tris (referred to as T); in the presence ... determined the F structure containing the truncated region of the C-terminal domain; however, we failed to determine the structure of the intact glutaminase because the crystals exhibited heavy twinning ... to determine nearly the full-length structure of Mglu in the presence and absence of l-glutamate and Tris (N, T, G and TG) l-Glutamate was identified in the G and TG structures, and Tris was identified...
  • 11
  • 151
  • 0

Báo cáo khoa học: Mycobacterium tuberculosis possesses a functional enzyme for the synthesis of vitamin C, L-gulono-1,4-lactone dehydrogenase doc

Báo cáo khoa học: Mycobacterium tuberculosis possesses a functional enzyme for the synthesis of vitamin C, L-gulono-1,4-lactone dehydrogenase doc
... (Paris, France): 5forGulox (forward), 5¢-GGGGACAAGTTT GTACAAAAAAGCAGGCTTCGATGACGACGACAAG ATGAGCCCGATATGGAGTAATTGGCCT-3¢; and 3revGulox (reverse), 5¢-GGGGACCACTTTGTACAAGAAA GCTGGGTCTCAGGGACCGAGAACGCGCCGGGTGT ... as a direct electron acceptor The animal and plant l-gulonolactone oxidoreductases are also active towards the l-galactono-1,4-lactone substrate Only scarce data are available on the presence of ... Arabidopsis thaliana L-galactono-1,4-lactone dehydrogenase (GLDH), At3g47930; Arabidopsis thaliana putative L-gulono-1,4-lactone dehydrogenase, At2g46740; Sus scrofa L-gulono-1,4-lactone oxidase...
  • 11
  • 183
  • 0

Báo cáo khoa học: Characterization of a cathepsin L-associated protein in Artemia and its relationship to the FAS-I family of cell adhesion proteins pot

Báo cáo khoa học: Characterization of a cathepsin L-associated protein in Artemia and its relationship to the FAS-I family of cell adhesion proteins pot
... CLAP_1:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTAAAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT CLAP_2:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTAAAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT ... CLAP_2:ATTAGTGCTATAGTTTGGGAAATATTTAGTCCTTGTTTTGTGTGATCTTATAAGATAATATTTGTAGTTTGTGCTTTTATATAATTTAGCTCATTGGATT 1730 * 1888 CLAP_1:AAGATCTTCTGAATGTGATTATATGCGGCTGTGTTTTCTAATAGATTTCTAGATACGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA CLAP_2:AAGATCTTCTGAATGTGATTATATGCGGCTGTGTTTTCTAATAGATTTCTAGATACGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA (A) 48 ... CLAP_1:AAGTCTGTCGTCAAAATGTTATGAACGTCTCTTGTCATAAAGAAAGATAACCTCTCTTTTTAGTTTGGTTTAGATATTAAGGACAGATCCAAAATATTTG CLAP_2:AAGTCTGTCGTCAAAATGTTATGAACGTCTCTTGTCATAAAGAAAGAGAACCTCTCTTTTTAGTTTGGTTTAGATATTAAGGACAGATCCAAAATATTTG * CLAP_1:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTAAAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT...
  • 12
  • 190
  • 0

CONFIRMATION OF REPRESENTATIVE HILDA L. SOLIS pptx

CONFIRMATION OF REPRESENTATIVE HILDA L. SOLIS pptx
... hearing from you now STATEMENT OF HILDA L SOLIS, MEMBER OF THE HOUSE OF REPRESENTATIVES FOR CALIFORNIA (32d CONGRESSIONAL DISTRICT), LOS ANGELES COUNTY, CA Mrs SOLIS Thank you, Mr Chairman I, ... welcome Representative Solis, with whom I served in the U.S House of Representatives on the Education and Labor Committee We had a great meeting, days ago in my office, and discussed many of the ... from the State of Iowa, prepared statement Isakson, Hon Johnny, a U.S Senator from the State of Georgia Prepared statement Solis, Hon Hilda L., a U.S Representative...
  • 77
  • 26
  • 0

Xem thêm

Nạp tiền Tải lên
Đăng ký
Đăng nhập