Delayed ripening and improved fruit processing quality in tomato by RNAi mediated silencing of three homologs of 1 aminopropane 1 carboxylate synthase gene

báo cáo khoa học: " Use of the evidence base in substance abuse treatment programs for American Indians and Alaska natives: pursuing quality in the crucible of practice and policy" ppsx

báo cáo khoa học:
... article as: Novins et al.: Use of the evidence base in substance abuse treatment programs for American Indians and Alaska natives: pursuing quality in the crucible of practice and policy Implementation ... that for the rest of the United States - substance abuse programs were transferred from the National Institute of Alcohol Abuse and Alcoholism to the IHS in 1978 [59], and the training of counselors ... improve the quality of services for AI/ANs with substance use problems The initiatives to increase the use of EBTs in substance abuse programs have certainly grown out of a strong, nationwide and...
  • 12
  • 63
  • 0

Báo cáo khoa học: The ATPase activities of sulfonylurea receptor 2A and sulfonylurea receptor 2B are influenced by the C-terminal 42 amino acids doc

Báo cáo khoa học: The ATPase activities of sulfonylurea receptor 2A and sulfonylurea receptor 2B are influenced by the C-terminal 42 amino acids doc
... lacked the last 42 amino acids Figure 2A and Table show that the ATPase activity of NBD2-DC was greater than that of SUR2B but similar to that of NBD2A, favoring the idea that the last 42 amino acids ... than those for the NBDs of SUR2A [22] SUR2A and SUR2B differ only in their last 42 amino acids, which not form part of the catalytic site Thus, these amino acids may interact with the NBDs to modulate ... (site and site 2) that comprise the Walker A and Walker B motifs of one NBD and the linker domain of the other In the absence of Mg2+, there is little difference in ATP block of Kir6.2 ⁄ SUR2A and...
  • 9
  • 129
  • 0

Báo cáo khoa học: Rapamycin inhibits lipopolysaccharide induction of granulocyte-colony stimulating factor and inducible nitric oxide synthase expression in macrophages by reducing the levels of octamer-binding factor-2 doc

Báo cáo khoa học: Rapamycin inhibits lipopolysaccharide induction of granulocyte-colony stimulating factor and inducible nitric oxide synthase expression in macrophages by reducing the levels of octamer-binding factor-2 doc
... octamer and the factors binding to it in LPS-induced gene expression Although involvement of octamer-binding factor- 1 (Oct-1), another octamer-binding protein, cannot be excluded in the LPSinduced expression ... expression of iNOS and G-CSF protein and mRNA were evaluated in macrophages, and the involvement of Oct-2 in LPS ⁄ mTOR-induced iNOS and G-CSF expression was investigated further Results Rapamycin inhibits ... and be inhibited by the mTOR inhibitor, rapamycin In addition, Oct-2 is involved in the expression of LPS -inducible genes that contain octamer in their promoters [24,25] Thus, rapamycin may inhibit...
  • 12
  • 138
  • 0

Báo cáo khoa học: "Immunomodulatory and antitumor effects in vivo by the cytoplasmic fraction of Lactobacillus casei and Bifidobacterium longum" pot

Báo cáo khoa học:
... results was reported by other researchers with the direct intraperitoneal injection of L casei 9018 against the sarcoma-180 [19,27] For the antitumor activity of LABs in vivo, the increased specific ... 3) These strains were selected for further study in vivo Increased CD8+ T cells in two color analysis of flow cytometry The change of T cell subsets was observed after oral administration of cytoplasmic ... LABs in adjusting feeding condition of experimental groups To evaluate the antitumor effects, F9 teratocarcinoma cells (1 × 106 cells/ mouse) were inoculated i.p at the day of 14th The change of...
  • 8
  • 150
  • 0

Báo cáo y học: "Genetic polymorphisms in PTPN22, PADI-4, and CTLA-4 and risk for rheumatoid arthritis in two longitudinal cohort studies: evidence of gene-environment interactions with heavy cigarette smoking" potx

Báo cáo y học:
... whether they currently smoked and the number of cigarettes smoked per day From these reports, we calculated pack years of smoking (product of years of smoking and packs of cigarettes per day) Other ... in controls and 14% in cases) In analyses involving CTLA-4 and PADI-4, we assessed the risk for RA in dominant, additive, and recessive models Gene-environment and gene-gene interactions We conducted ... dRF-negative RA cases and all controls eP for AP, one of the indices of additive interactions between binary PTPN22 genotype and binary HLA-SE genotype f95% confidence interval and P value for AP not applicable...
  • 12
  • 126
  • 0

Báo cáo y học: "Distribution of airway narrowing responses across generations and at branching points, assessed in vitro by anatomical optical coherence tomography" docx

Báo cáo y học:
... airway narrowing [34,35] A number of explanations can be offered as to why airway narrowing is maintained at regions of branching One may be that the structural complexity at the dividing point ... HW: Airway narrowing assessed by anatomical optical coherence tomography in vitro: dynamic airway wall morphology and function J Appl Physiol 2009 24 Sparrow MP, Mitchell HW: Modulation by the ... reports in pig bronchi in vitro in which airway narrowing was measured endoscopically in separate large and small diameter airways [7] The present study extends these findings by documenting narrowing...
  • 12
  • 58
  • 0

Báo cáo khoa học: Involvement of lysine 1047 in type I collagen-mediated activation of polymorphonuclear neutrophils doc

Báo cáo khoa học: Involvement of lysine 1047 in type I collagen-mediated activation of polymorphonuclear neutrophils doc
... (contained within the cyclic peptide CTRKKHDNAQC derived from jararhagin disintegrin) is essential for binding to the I domain of a2 integrins [24] Similarly, members of the lysine threonine–serine ... oxidase-hypoxanthine system (data not shown) These results suggested the involvement of lysine- containing sequences in the activation mechanism Involvement of lysine residues contained within a1CB6 peptides In ... A, Wiman B & Pap S (2003) Identification of amino acids in antiplasmin involved in its noncovalent lysine- binding-site’-dependent interaction with plasmin Eur J Biochem 270, 2023–2029 Panizzi P,...
  • 10
  • 208
  • 0

Báo cáo khoa học: Calcium-independent phospholipase A2-mediated formation of 1,2-diarachidonoyl-glycerophosphoinositol in monocytes potx

Báo cáo khoa học: Calcium-independent phospholipase A2-mediated formation of 1,2-diarachidonoyl-glycerophosphoinositol in monocytes potx
... increased rate of arachidonatephospholipid remodeling Lack of involvement of group IV and group VI phospholipase A2 in remodeling and increased susceptibility of proliferating T cells to CoA-independent ... concentrations that involves the direct acylation of both the sn-1 and sn-2 positions of PtdIns 1,2-Diarachidonoyl-glycerophosphoinositol Results Initial incorporation of [2H]AA into PtdIns When monocyte ... incorporation of exogenous [2H]AA into PtdIns To directly study the role of deacylation–reacylation reactions in the incorporation of AA into PtdIns, we conducted experiments in the presence of the...
  • 12
  • 118
  • 0

Báo cáo khoa học: RNAi-mediated knockdown of juvenile hormone acid O-methyltransferase gene causes precocious metamorphosis in the red flour beetle Tribolium castaneum pdf

Báo cáo khoa học: RNAi-mediated knockdown of juvenile hormone acid O-methyltransferase gene causes precocious metamorphosis in the red flour beetle Tribolium castaneum pdf
... for each gene more abundant in the posterior part of the sixth larval instar (Fig 3A,B) and at the beginning of the prepupal stage in the seventh larval instar (Fig 3D,E) In the sixth instar larvae, ... beginning of the fourth larval instar As 2924 Fig Efficiency of RNAi-mediated knockdown in Tribolium castaneum (A) The level of TcMT1 transcript days after injection with dsRNA of EGFP or TcMT1 in ... the beginning of the sixth instar to the larvae that had received TcMT3 dsRNA, the majority (94%, n = 16) moulted into the seventh instar (Table 3) Thus, JHM application at the beginning of the...
  • 13
  • 137
  • 0

Báo cáo khoa học: "Calcium metabolism in cows receiving an intramuscular injection of 1,25-dihydroxyvitamin D3 combined with prostaglandin F2?? closely before parturition" doc

Báo cáo khoa học:
... marked increase in plasma Ca and iP 2 3 3 3 2 3 3 2 Effect of 1,25-dihydroxyvitamin D3 and induced parturition in cows We thank Dr Azuma Watanabe (Mercian Corporation, Japan) for supplying the ... occurred in one cow of control group within 10 hours of parturition and in another of 1,25(OH) D group at days postpartum These two cows received Ca treatment (an intravenous infusion of 500 ml of ... was the difficulty in timing the treatment In the present study, we suggested that the prophylactic regimen using the intramuscular injection of 1,25(OH) D combined with the induced parturition...
  • 3
  • 61
  • 0

báo cáo khoa học: " RNAi-mediated knockdown of cyclooxygenase2 inhibits the growth, invasion and migration of SaOS2 human osteosarcoma cells: a case control study" ppt

báo cáo khoa học:
... 5’TCGAGAAAAAAaaTCACATTTGATTGACAGTCCActcttgaTGG ACTGTCAATCAAATGTGATTA3’ LV- COX-2siRNA-3 Oligo1: 5’TaaCCTTCTCTAACCTCTCCTATTtcaagagAATAGGAGAGGTT AGAGAAGGTTTTTTTTC3’ Oligo2: 5’TCGAGAAAAAAaaCCTTCTCTAACCTCTCCTATTctcttgaAAT AGGAGAGGTTAGAGAAGGTTA3’ ... 5’TCGAGAAAAAAaaACACAGTGCACTACATACTTActcttgaTAA GTATGTAGTGCACTGTGTTTA3’ LV- COX-2siRNA-2 Oligo1: 5’TaaTCACATTTGATTGACAGTCCAtcaagagTGGACTGTCAATC AAATGTGA TTTTTTTTC3’ Oligo2: 5’TCGAGAAAAAAaaTCACATTTGATTGACAGTCCActcttgaTGG ... http://www.jeccr.com/content/30/1/26 Page of Table Interfering sequence specified for COX-2 gene Sequence LV-COX-2siRNA-1 Oligo1: 5’TaaACACAGTGCACTACATACTTAtcaagagTAAGTATGTAGTG CACTGTGTTTTTTTTTC3’ Oligo2: 5’TCGAGAAAAAAaaACACAGTGCACTACATACTTActcttgaTAA...
  • 9
  • 67
  • 0

Báo cáo y học: "Inhibition of TNFalpha in vivo prevents hyperoxia-mediated activation of caspase 3 in type II cells" pdf

Báo cáo y học:
... deficiency Free Radic Biol Med 2001, 30 :1145-11 53 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 Sinha P, Kolleck I, Volk HD, Schlame M, Rüstow B: Vitamin E deficiency sensitizes alveolar type II ... respiratory distress syndrome [ 13] , and hyperoxia-mediated increase of total lung p 53 protein expression [14] alveolar type II cells (TIIcells) are severely damaged, culminating in apoptotic death TIIcells ... better understanding of the underlying pathways of hyperoxia-induced pulmonary damage Severe, long lasting hyperoxia causes an inflammatory reaction with an influx of inflammatory cells, cell proliferation...
  • 16
  • 43
  • 0

Báo cáo y học: " Lung cancer induced in mice by the envelope protein of jaagsiekte sheep retrovirus (JSRV) closely resembles lung cancer in sheep infected with JSRV" pot

Báo cáo y học:
... the question of how closely tumors induced by JSRV Env in mice resemble those induced by JSRV in sheep, in part to determine if the oncogenic activity of Env can entirely account for the disease ... tumors induced by administration of an AAV6 vector that expresses only the ENTV Env protein [12] Mab staining of tumors from sheep We next tested the Mab for staining of lung tumors in sheep with ... of the majority of lung tumors in sheep infected with JSRV and in mice expressing only the JSRV Env protein is remarkably similar, indicating that Env expression alone can explain much of the...
  • 15
  • 50
  • 0

Báo cáo sinh học: "Selection for uniformity in livestock by exploiting genetic heterogeneity of residual variance" pot

Báo cáo sinh học:
... sib testing scheme (σ2 ) for different E,1 45 Selection for uniformity in livestock Table II Genetic gaina after one generation of index selection in sib testing schemes for different values of σ2 ... The effect of inbreeding level of a parent on Mendelian sampling variance in its progeny can be eliminated, however, by adjusting the within-family variance for the inbreeding level of the parents ... possibilities for exploiting genetic heterogeneity of residual variance to change both the mean and the variance of a trait by index selection were explored In general, for most traits the heritability of...
  • 23
  • 44
  • 0

Báo cáo khoa học nông nghiệp " Commercial and High Quality Cultivars of Root and Tuber Crops for Processing Purpose in the Northern and Central Vietnam " potx

Báo cáo khoa học nông nghiệp
... while the production cost was still high I Background The project "Development and Selection of Commercial and High Quality Cultivars of Root and Tuber Crops for Processing Purpose in the Northern ... 10-20% tubers were boiled and used, and about 10% of tuber was sale in the market The result of the investigation on people point of view about the cultivation of sweet potato in the future indicated ... multiplied planting materials in their own garden by using the stems There was no farmer using the tuber roots as the initiated source for the multiplication of planting materials The use of different...
  • 27
  • 105
  • 0

Xem thêm

Từ khóa: mpi program to carry out a trapezoid rule integration in parallel by assigning one block of loop iterations to each ue and performing a reductionuniversal plug and play a technology introduced in 1999 bypeptides nucleotides hormones and proteins have been studied in recent years with varying degrees of success janiak and kofinas 2007 and there has been a steady increase in the volume of literature in th2008 authority to free members of the armed forces of the united states and certain other persons detained or imprisoned by or on behalf of the interna tional criminal courtβ is selectively blocked in vitro by a competitive excess of hicsuppression of c1q production in dc by the yeast derived stimulus zymosan through dectin 1advances in the transformation method and applications for obtaining lines with improved bread making quality and low toxicity in relation to celiac diseasecost of quality in small and mediumsized enterprises case of an indian engineering companyquality control technician food processing jobs in ontariocurrent issues in biomedical text mining and natural language processingtargets and standards of quality in sport servicesworkshop on hyperspectral image and signal processing evolution in remote sensing whispersworkshop on hyperspectral image and signal processing evolution in remote sensinghyperspectral image and signal processing evolution in remote sensingcentral processing unit in computer organization and architectureGIAO TRINH CHUONG 6GIAO TRINH CHƯƠNG 2 DAO ĐỘNG SÓNG p3hệ thống đo lường và điều khiểnGIAO TRINH CHUONG 5 CO SO CUA KY THUATGIAO TRINH c7b CO SO TU DONGTHUYET TRINH THUC TAP DIEN TU 2GIAO TRINH DUC LI TAMGIAO TRINH KIEMTRA NGSACH m4GIAO TRINH QHTN 2a QUY HOACH THUC NGHIEMGIAO TRINH CHƯƠNG 2 DAO ĐỘNG SÓNG p1GIAO TRINH CHUONG 6 KY NANG LAM VIEC NHOMGIAO TRINH DUC AP LUCGIAO TRINH HINH THAI HINH HOC VA CAU TRUC TINH THEđề thi quy hoạch tuyến tính lần 1SÂN PHÂN PHỐI 500kV VÀ TRẠM BIẾN ÁP TỰ DÙNGGIAO TRINH TÍCH PHÂN ĐƯỜNG LOẠI 2GIAO TRINH CHƯƠNG 1 TRƯỜNG điện từNghiên cứu kỹ thuật tra cứu cứu ảnh và ứng dụng trong tra cứu cây thuốcNghiên cứu mạng nơron và ứng dụng trong khảo sát, đánh giá, thống kê kết quả học tập tại trường đại học công nghệ quảng ninhNghiên cứu phương pháp lọc spam và ứng dụng trong bảo mật hệ thống thư điện tử tại sở thông tin và truyền thông tỉnh nam định
Nạp tiền Tải lên
Đăng ký
Đăng nhập