1.3 Who should pay for higher educationquestions

Health Care for the Elderly - How Much? Who Will Pay For It pot

Health Care for the Elderly - How Much? Who Will Pay For It pot
... If so, the key question is not, “Shall we it? ” but rather, Who will pay? ” If expenditures continue to grow at the same rate as they have in the past, health care for the elderly in 2020 will require ... growth of health care spending on the elderly or find ways to pay for the additional care • SLOW THE GROWTH OF HEALTH CARE SPENDING Only three routes exist to slowing the growth of health care spending: ... to pay for future increases in health care Long-term reform of medicare (and Social Security) must face three harsh but inescapable facts First, total expenditures for health care of the elderly...
  • 5
  • 100
  • 0


... short-term risk This "myopic demand'' for long-term bonds can be large when risk aversion is small, because long-term bonds have attractive Sharpe ratios Second, long-term investors may hold long-term ... conventional wisdom, long-term bonds are appropriate for long-term investors who value stability of income We develop a model of optimal consumption and portfolio choice for infinitely-lived investors ... bonds for hedging purposes Long-term bonds can finance a stable longrun consumption stream even in the face of time-varying short-term interest rates, and this is attractive to risk-averse long-term...
  • 56
  • 165
  • 1

Báo cáo khoa học: NovelN,N¢-diacyl-1,3-diaminopropyl-2-carbamoyl bivalent cationic lipids for gene delivery – synthesis,in vitro transfection activity, and physicochemical characterization docx

Báo cáo khoa học: NovelN,N¢-diacyl-1,3-diaminopropyl-2-carbamoyl bivalent cationic lipids for gene delivery – synthesis,in vitro transfection activity, and physicochemical characterization docx
... (2004) Physicochemical optimisation of plasmid delivery by cationic lipids J Gene Med 6, S24 S35 15 Wasungu L & Hoekstra D (2006) Cationic lipids, lipoplexes and intracellular delivery of genes ... diameter around lm Use of DOPE and cholesterol to enhance the genedelivery properties of cationic lipids has been extensively documented [1621] For 1,3lb2 and 1,3lb3, transfection activity was appreciably ... cytofectins for gene delivery M Spelios and M Savva 18 Ferrari ME, Rusalov D, Enas J & Wheeler CJ (2002) Synergy between cationic lipid and co-lipid determines the macroscopic structure and transfection...
  • 15
  • 150
  • 0

Báo cáo khoa học: Novel b-1,3-, 1,6-oligoglucan elicitor from Alternaria alternata 102 for defense responses in tobacco docx

Báo cáo khoa học: Novel b-1,3-, 1,6-oligoglucan elicitor from Alternaria alternata 102 for defense responses in tobacco docx
... isolated from A alternata 102 Our previous work has indicated that the filtrate obtained from autoclaved A alternata 102 culture was able to induce marked chitinase activity in tobacco 2422 A alternata1 02 ... responses induced by AaGlucan in the intact tobacco plant seems similar to those induced by laminarin, which was reported to reduce pathogen infection [11], it Novel b-glucan elicitor from A alternata ... b-glucans During the course of a search for a potent elicitor of defense responses in a model plant cell (tobacco BY-2 cells), we found that the fungal strain Alternaria alternata 102 produces...
  • 11
  • 174
  • 0

Báo cáo Y học: ik3-1/Cables is a substrate for cyclin-dependent kinase 3 (cdk 3) pdf

Báo cáo Y học: ik3-1/Cables is a substrate for cyclin-dependent kinase 3 (cdk 3) pdf
... residue is also phosphorylated by both cdk3/cyclin A and cdk3/E in vivo (Fig 5) Analysis of ik3-1 amino-acid sequence indicates that ik3-1 has a putative ZRXL (Z and X are typically basic) motif that ... previously [11] To replace Ser274 in ik3-1 cDNA with Thr or Ala, mutagenic primers, 50 -TCTCCGGAGATGTCGAACACT CTCAGGTACTCCCAGACCA -30 or 50 -TCTCCGGAGAT GTCGAACACTCTCAGGTGCTCCCAGACCA -30 (corresponding ... that cyclin/ cdk3 actually phosphorylates ik3-1 P70ik3-1 is phosphorylated by either cyclin A/ cdk3 or cyclin E/cdk3 in vivo Furthermore, to examine whether p70ik3-1 is also phosphorylated by...
  • 7
  • 152
  • 0

Báo cáo hóa học: " GaInNAs-based Hellish-vertical cavity semiconductor optical amplifier for 1.3 μm operation" potx

Báo cáo hóa học:
... JE: 1.3 m vertical -cavity amplifier IEEE Photonics Technol Lett 2000, 12:951 Bjorlin S, Abraham P, Pasquariello D, Piprek J, Chiu Yi-J, Bowers JE: High gain, high efficiency vertical -cavity semiconductor ... PL: photoluminescence; QWs: quantum wells; VCSEL: vertical cavity surface emitting laser; VCSOA: vertical cavity semiconductor optical amplifier Acknowledgements F.AI Chaqmaqchee is grateful to ... Bowers JE: Optical gain-bandwidth product of verticalcavity laser amplifiers Electron Lett 2001, 37:298 Karim A, Bjorlin S, Piprek J, Bowers JE: Long-wavelength vertical -cavity lasers and amplifiers...
  • 7
  • 97
  • 0

Giáo án tiếng anh lớp 5 - UNIT 9 ACTIVITIES FOR NEXT SUNDAY Section B (1-3) Period 45 doc

Giáo án tiếng anh lớp 5 - UNIT 9 ACTIVITIES FOR NEXT SUNDAY Section B (1-3) Period 45 doc
... Play game: Let’s talk F -Guide Ss to exercises 2.F T -Play game - < /b> Do exercises 8, in work book -T remarks the lesson -Learn by heart new words and structures -Prepare next < /b> lesson ... football? B: No I’m going to play volleyball (Yes, I am./No, I’m not) b Vocabulary: to take along(mang theo), cook lunch, next < /b> Sunday < /b> II TEACHING AIDS: Teacher’s: A cassette, puppets Students’: book, ... repeat a- Pre listen T says about the situation in the dialogue Look, Listen New words: next < /b> Sunday < /b> to take along -Guide Ss use questions: -Look, listen and repeat A: What are you going to next...
  • 6
  • 439
  • 0

Báo cáo khoa học: " Cap-independent protein translation is initially responsible for 4-(N-methylnitrosamino)-1-(3-pyridyl)-butanone (NNK)-induced apoptosis in normal human bronchial pithelial cells" pot

Báo cáo khoa học:
... capindependent protein translation was responsible for early apoptosis To understand the relative roles of cap-dependent and -independent protein translations in NNK-induced apoptosis in human bronchial ... transfection with bicistronic constructs To determine the status of cap-dependent and independent protein translation in NNK-induced apoptosis in human bronchial epithelial cells, we performed transient ... Rapamycin inhibits cap-dependent, but not cap-independent translation [2,17] In this study, we hypothesized that state of protein translation could play an important role in NNK-induced apoptosis...
  • 10
  • 66
  • 0

Báo cáo khoa học: "Molecular analysis of hprt mutation in B6C3F1 mice exposed to ozone alone and combined treatment of 4-(N-methyl-N-nitrosamino)-1-(3-pyridyl)-1-butanone and/or dibutyl phthalate for 32 and 52 weeks" ppsx

Báo cáo khoa học:
... hypoxanthineguanine phosphoribosyltransferase (hprt) locus of lymphocytes isolated from spleens of mice following exposure to ozone, NNK, and DBP, and combined treatments of NNK and DBP on ozone for 32- ... Molecular analysis of hprt mutation 383 Table DNA sequence analysis of hprt mutant in splenic cells of B6C3F1 male mice in 52- wk study Type of mutation Number of mutants Control Ozone NNK DBP** Ozone+ NNK ... (Figs and 2) Analysis of hprt mutations in T-cells from spleens of control and test materials -exposed B6C3F1 mice Analysis of the spontaneous hprt mutant clones yielding The toxicologic actions of...
  • 7
  • 156
  • 0

Báo cáo khoa học: "SemiWhole brain radiotherapy with a conformational external beam radiation boost for lung cancer patients with 1-3 brain metastasis: a multi institutional study" pdf

Báo cáo khoa học:
... presented with extra cranial failure/local brain failure/distant brain failure and extra cranial failure/distant brain failure, respectively Extra cranial failure and local brain failure only was observed ... metastases patients treated with accelerated-fractionation vs accelerated-hyperfractionated radiotherapy: an analysis from Radiation Therapy Oncology Group Study 91-04 International journal of radiation ... Y: Radiotherapy of brain metastases from carcinoma of the bronchus Clinical radiology 1989, 40:193-194 Page of 15 Egawa S, Tukiyama I, Akine Y, Kajiura Y, Yanagawa S, Watai K, Nomura K: Radiotherapy...
  • 8
  • 195
  • 0

Báo cáo khoa học: "Postmastectomy irradiation in breast in breast cancer patients with T1-2 and 1-3 positive axillary lymph nodes: Is there a role for radiation therapy" ppsx

Báo cáo khoa học:
... Cite this article as: Cosar et al.: Postmastectomy irradiation in breast in breast cancer patients with T1-2 and 1-3 positive axillary lymph nodes: Is there a role for radiation therapy? Radiation ... DMe Alive DM Death DM Death DM Death DM Death DM Alive Out-come a Lateral, bMedial, cInvasive ductal carcinoma, dInvasive Paget’s disease, eDistance metastasis patients had lung metastasis and ... is being examined in a randomized clinical trial” Many surgeons and radiation oncologist are not recommending PMRT to 1-3 axillary lymph node positive patients with a common understanding that...
  • 8
  • 132
  • 0

nvestigating the influences of tidal inundation and surface elevation on the establishment and early development of mangroves for application in understanding mangrove rehabilitation techniques 1 3

nvestigating the influences of tidal inundation and surface elevation on the establishment and early development of mangroves  for application in understanding mangrove rehabilitation techniques 1  3
... Surface elevations in mangroves, and its inherent control on periods of inundation and drainage, are therefore critical determinants of forest health For example, hyper- and hypo-salinity resulting ... periods, and hence surface elevations The general relationship between inundation durations and physiological functioning of mangroves is that prolonged inundation (from low surface elevations) impedes ... comprises of five inundation classes, with details on the frequency of 16 inundation per month and dominant mangrove species for each respective class For example, mangroves in Inundation Class will...
  • 16
  • 70
  • 0

Xem thêm

Từ khóa: why should taxpayers pay for birth controlwhy should taxpayers pay for abortionswhy should taxpayers pay for stadiumswho should write a letter of recommendation for medical schooljava api for xml processing jaxp 1 3microsoft net framework 3 5 offline installer for windows 8 1Tuyển tập 36 đề thi thử THPT quốc gia môn hóa – thầy tào mạnh đứcBÁO CÁO THNN Công tác tuyển dụng nguồn nhân lựcTính tiên phong đi trước đối thủ trong các hoạt động kinh doanh của doanh nhân việt namMẸO THI BẰNG XE MÁY CÓ KÈM THEO PHẦN MỀM TEST.Phát triển nguồn nhân lực trong các trường đại học ngoài công lập trên địa bàn thành phố hà nộiCách làm hồ sơ đăng ký thi THPT quốc gia năm 2017PHÁP LUẬT VIỆT NAM VỀ TẬP SỰ HÀNH NGHỀ LUẬT SƯBộ đề kiểm tra 1 tiết môn GDCD lớp 12 năm 20162017 có đáp ánĐánh giá một số đặc tính sinh lý của bốn dòng nấm có khả năng phân hủy vật liệu hữu cơ phân lập từ nền đất thâm canh lúa tại xã Phong Hòa, huyện Lai Vung, tỉnh Đồng ThápĐáp án cuộc thi tìm hiểu 90 năm tác phẩm đường kách mệnh và 70 năm tác phẩm sửa đổi lối làm việc của tác giả hồ chí minhTuyen chon de thi vao 10 v2 1Quản lý xã hội đối với dân di cư tự do ở huyện krông bông, tỉnh đắk lắk hiện nayTÀI LIỆU CHUYÊN đề CÁCH MẠNG xã hội CHỦ NGHĨA và một số vấn đề có TÍNH QUY LUẬT của CÁCH MẠNG xã hội CHỦ NGHĨATÀI LIỆU CHUYÊN đề HÌNH THÁI KINH tế xã hội CỘNG sản CHỦ NGHĨA và đặc TRƯNG cơ bản của CHỦ NGHĨA xã hội, THỜI kỳ QUÁ độ lên CHỦ NGHĨA xã hội ở VIỆT NAMTÀI LIỆU CHUYÊN đề NHỮNG vấn đề có TÍNH NGUYÊN tắc TRONG đấu TRANH CHỐNG CHỦ NGHĨA cơ hội xét lại, CHỦ NGHĨA xã hội dân CHỦTÀI LIỆU CHUYÊN đề tư TƯỞNG NHÂN văn hồ CHÍ MINH và vận DỤNG tư TƯỞNG NHÂN văn hồ CHÍ MINH TRONG sự NGHIỆP đổi mới HIỆN NAYTÀI LIỆU CHUYÊN đề tôn GIÁO và GIẢI QUYẾT vấn đề tôn GIÁO TRONG QUÁ TRÌNH xây DỰNG CHỦ NGHĨA xã hộiTÀI LIỆU CHUYÊN đề tư TƯỞNG hồ CHÍ MINH về bạo lực các MẠNG và GIÁ TRỊ đối với sự NGHIỆP CÁCH MẠNG của ĐẢNG và NHÂN dân TATÀI LIỆU CHUYÊN đề tư TƯỞNG hồ CHÍ MINH về NGHỆ THUẬT QUÂN sự NHỮNG GIÁ TRỊ lý LUẬN và THỰC TIỄN TRONG sự NGHIỆP xây DỰNG và bảo vệ tổ QUỐC HIỆN NAYTÀI LIỆU CHUYÊN đề tư TƯỞNG hồ CHÍ MINH về NHÀ nước KIỂU mới và một số vấn đề xây DỰNG NHÀ nước VIỆT NAM dưới ÁNH SÁNG tư TƯỞNG hồ CHÍ MINH