62790 esl 1 exam places in the neighborhood

Unit 1: A day in the life of. Listening

Unit 1: A day in the life of. Listening
... WHILE -LISTENING Listen and order these pictures WHILE -LISTENING Listen again and decide whether the statements are True (T) or False (F) Mr Lam lives in District Mr Lam usually gets up early After Mr Lam ... stall:/fu:d stɔ:l/ purchase:/'pə:t∫əs/ drop:/drɔp/ passengers:/'pæsindʒə/ ride:/raid/ WHILE -LISTENING Look at the pictures and describe them WHILE -LISTENING Pre order these pictures WHILE -LISTENING ... District Mr Lam’s first passengers are two pupils Mr Lam has lunch at home with his family After lunch Mr Lam immediately goes back to work T F POST -LISTENING V HOMEWORK - T asks ss to remember the story...
  • 10
  • 11,016
  • 37

Unit 1-A day in the life of...

Unit 1-A day in the life of...
... screamed in panic Unit 1: A day in the life of Period 4: Writing Task Task 2: The climax: We thought we had only minutes to live Unit 1: A day in the life of Period 4: Writing Task Task 2: The ... and the conclusion of the story Unit 1: A day in the life of Period 4: Writing Task 2.Task 2: Format of a narrative Climax Events Conclusion Unit 1: A day in the life of Period 4: Writing ... begin S + Ved landed stared announced took began Unit 1: A day in the life of Period 4: Writing 1.Task 1: Find all the verbs that are used in past simple and the connectors in the story Key: The...
  • 20
  • 2,307
  • 5

Gián án Ụnit 1: A day in the life of...

Gián án Ụnit 1: A day in the life of...
... lead in: - It is Linh’sdaily routine -Do you have a daily routine? -is it same or different from Linh? 5ms 2.Pre-task: BRAIN STORM -ask ss think about some their activities in a day in m -after ... and find the winner Arrangeme nt T - whole class KEY: Get up have breakfast clean the floor learning 5.phoning 6.cooking have lunch 8.take a nap 9.sulf the internet 10 watch TV 11 go to the bed ... Stage / timing Prereading 5ms Activities warm-up GUESS THE ACTIVITIES * Instruction: -Divide class in to two teams: team A & team B -Show a video about linh’ daily routine in minute -ask ss...
  • 3
  • 1,547
  • 11

Tài liệu Activity 5.1: Identifying Keys in the Logical Model pdf

Tài liệu Activity 5.1: Identifying Keys in the Logical Model pdf
... 22 Activity 5.1: Identifying Keys in the Logical Model Exercise 1: Identifying Keys In this exercise, you will identify primary, foreign, and composite keys for a logical data model based on the ... Bardell, Inc case study ! Specify the keys in a logical data model Review the ER diagram on the next page Identify the areas of the ER diagram for which keys are necessary Write the keys in the space ... define the composite key, and then label their types as Primary or Foreign Next, you will discuss your answers with the class Activity 5.1: Identifying Keys in the Logical Model 23 Contract Contracts...
  • 4
  • 192
  • 0

Báo cáo khoa học: Suppression of a cold-sensitive mutant initiation factor 1 by alterations in the 23S rRNA maturation region pdf

Báo cáo khoa học: Suppression of a cold-sensitive mutant initiation factor 1 by alterations in the 23S rRNA maturation region pdf
... mutations that are located in the 23S rRNA processing stem (Fig 1) This structural region is subject to cleavage by RNase III and other ribonucleases during 23S rRNA maturation [16 ] In particular, ... sensitivity of mutant IF1 As we had established that processing defects in 23S rRNA act as suppressors of a cold-sensitive IF1 mutant, we reasoned that other similar defects in 50S maturation as a whole ... CGCGGATCAGGTGGGGATGTATTA; rnc5¢I comp, GGCAGTGGATGATGGGGTTCATGCGATACC; rnc3¢O SalI, TGCGTCGACATTTGCCGCAATAGTGTCAACA; and rnc3¢I comp, TGAACCCCATCATCCACTGCCAG GTCAGCG The deletion was constructed in...
  • 12
  • 236
  • 0

báo cáo hóa học: " Hypoxia-inducible factor-1 (HIF-1) is involved in the regulation of hypoxia-stimulated expression of monocyte chemoattractant protein-1 (MCP-1/CCL2) and MCP-5 (Ccl12) in astrocytes" pdf

báo cáo hóa học:
... across the BBB to the sites of axonal injury in the brain [33,37] Both in vitro and in vivo findings suggest that hypoxia/ischemia-induced infiltration of monocytes and macrophages contributes to the ... of inflammatory cytokines and chemokines during hypoxia; whereas NFκB is mainly involved in transcriptional regulation of these genes during the phase of reoxygenation [8,40] The temporal interplay ... MCP-5 gene and the observation that the expression of MCP-5 correlated with the levels of HIF-1α suggest that HIF-1α is involved in transcriptional regulation of MCP-5 expression in mouse astrocytes...
  • 15
  • 243
  • 0

báo cáo hóa học:" Role of the VEGF-Flt-1-FAK pathway in the pathogenesis of osteoclastic bone destruction of giant cell tumors of bone" pptx

báo cáo hóa học:
... VEGF activates the VEGF-Flt-1-FAK pathway The activation of this signaling pathway might be involved in the migration of these cells into the lesion at the site of bone destruction in GCTs We recently ... order to determine the possible role of the VEGF-Flt-1-FAK pathway in the pathogenesis of bone destruction in GCTs Methods Patients and tissue specimens The Institutional Review Board of Kyushu University ... and 4b) These results suggest that GCT-CM enhanced the chemotaxis and cell proliferation of OPCs via VEGF-Flt-1-FAK signaling Possible involvement of the VEGF-Flt-1-FAK pathway in the bone destruction...
  • 8
  • 201
  • 0

báo cáo hóa học:" Role of the VEGF-Flt-1-FAK pathway in the pathogenesis of osteoclastic bone destruction of giant cell tumors of bone" potx

báo cáo hóa học:
... VEGF activates the VEGF-Flt-1-FAK pathway The activation of this signaling pathway might be involved in the migration of these cells into the lesion at the site of bone destruction in GCTs We recently ... order to determine the possible role of the VEGF-Flt-1-FAK pathway in the pathogenesis of bone destruction in GCTs Methods Patients and tissue specimens The Institutional Review Board of Kyushu University ... and 4b) These results suggest that GCT-CM enhanced the chemotaxis and cell proliferation of OPCs via VEGF-Flt-1-FAK signaling Possible involvement of the VEGF-Flt-1-FAK pathway in the bone destruction...
  • 8
  • 118
  • 0

báo cáo hóa học:" Expression of interleukin-1 (IL-1) ligands system in the most common endometriosis-associated ovarian cancer subtypes" pdf

báo cáo hóa học:
... medicine 2008, 5:e232 doi:10.1186/1757-2215-3-3 Cite this article as: Keita et al.: Expression of interleukin-1 (IL-1) ligands system in the most common endometriosis-associated ovarian cancer ... 0.05) The levels of IL-1b in the supernatant of all ovarian cancer cell lines studied were Table Comparative expression of IL-1b and IL-1RA in endometrial cells and epithelial ovarian cancer ... 2) in endometrioid ovarian cancer cell compared to endometrial and ovarian cancer cells This is of further interest given that this subtype of ovarian cancer represents the major and the one of...
  • 8
  • 194
  • 0

Unit 1 A day in the lìe of - Reading

Unit 1 A day in the lìe of - Reading
... to talk, correct their pronunciation, grammar III Post- reading Talk about Mr.Vy and Mrs.Tuyet’s daily struture and vocabulary routines (look at the information in task to talk) - Summarize the ... does the transplanting Tell them to look back passages Yes, they are Because they love working and and take a brief note about Mr.Vy and Mrs.Tuyet’s daily routines they love their children Ask them ... field again, prepare the banks of the plot of pland He pumps water into th eplot of pland She does transplanting 6:30’ They finish work T: Ask Ss to work in groups 7:00 They have dinner Guide them...
  • 3
  • 1,502
  • 13

Giáo án tiếng anh 10: Unit 1 : A day in the life of... Reading ppsx

Giáo án tiếng anh 10: Unit 1 : A day in the life of... Reading ppsx
... mistakes Quan have at 8.55 on Monday? B: He has maths at 8.55 on Monday - Open the books - Do task in groups A: Quan gets up at 14 .00 B: He does his homework at 14 .15 C: He watches T.V at 16 .30 - ... - Read the narrative - Ask the teacher if necessary - Look through the passage again and find all the verbs that used in the past simple and the connectors - Let them work in groups - Work in ... minutes) - Ask students to look through the passage and read in silence - Help students read the passage - Explain pronunciation and meaning of new words which appear in the passage Task : (3 minutes)...
  • 13
  • 4,233
  • 14

Giáo án tiếng anh 10: Unit 1 : A day in the life of... Reading doc

Giáo án tiếng anh 10: Unit 1 : A day in the life of... Reading doc
... learn Unit 1- part A: Reading - Listen to the teacher and open Before you read : (7 the book – Unit 1, minutes) part A: reading - Ask students to use the suggestion in their books to work in pairs ... read the passage - Listen teacher then read - Explain pronunciation and the passages meaning of new words - Ask some new which appear in the passage words if necessary Task : (3 minutes) - Ask ... open the Pre-writing: (10 minutes) books - Ask student to read the narrative in task - Explain some new words - Read the - Ask students to look narrative through the passage again - Ask the teacher...
  • 38
  • 5,467
  • 9

Giáo án tiếng tiếng anh lớp 7: Unit 1 : A day in the life of... ppsx

Giáo án tiếng tiếng anh lớp 7: Unit 1 : A day in the life of... ppsx
... learn Unit 1- part A: Reading - Listen to the teacher and open Before you read : (7 the book – Unit 1, minutes) part A: reading - Ask students to use the suggestion in their books to work in pairs ... read the passage - Listen teacher then read - Explain pronunciation and the passages meaning of new words - Ask some new which appear in the passage words if necessary Task : (3 minutes) - Ask ... open the Pre-writing: (10 minutes) books - Ask student to read the narrative in task - Explain some new words - Read the - Ask students to look narrative through the passage again - Ask the teacher...
  • 38
  • 741
  • 0

Xem thêm

Nạp tiền Tải lên
Đăng ký
Đăng nhập