6027 a is for apple preschool activity

Tài liệu Báo cáo khoa học: Characterization of promoter 3 of the human thromboxane A2 receptor gene A functional AP-1 and octamer motif are required for basal promoter activity docx

Tài liệu Báo cáo khoa học: Characterization of promoter 3 of the human thromboxane A2 receptor gene A functional AP-1 and octamer motif are required for basal promoter activity docx
... Prm3 was performed using the mutator primers Kin175 (5¢-CACCAGAGCTACTTACA CTGAATTCCAGAATAATCACAAGCAAATC -3 ; sense primer) vs its complement generating pGL3b:Prm3aOCT)1*, pGL3b:Prm3abOCT)1* and ... Prm3aaAP)1*, pGL3e:Prm3aaAP)1*, pGL3b:Prm3aaaAP)1* and pGL3e:Prm3aaaAP)1* Mutation of the Oct-1 element with the sequence aaA TGCa to aaTTCCa (core bases shown in uppercase letters) centered at )1 23 within ... Prm3aab; pGL3b:Prm3aab & pGL3e:Prm3aab (Primer Kin160; 5¢-dGAGAGGTACCGCAAATCTTCTCTCGCC TCC -3 , corresponding to NTs )106 to )86) (8) Prm3aaa; pGL3b:Prm3aaa & pGL3e:Prm3aaa (Primer Kin161, 5¢-dGAGAGGTACCGCAGCATCGGCCTGATG...
  • 18
  • 178
  • 0

Tài liệu Báo cáo khoa học: Experimental proof for a signal peptidase I like activity in Mycoplasma pneumoniae, but absence of a gene encoding a conserved bacterial type I SPase pdf

Tài liệu Báo cáo khoa học: Experimental proof for a signal peptidase I like activity in Mycoplasma pneumoniae, but absence of a gene encoding a conserved bacterial type I SPase pdf
... protein, additional information about post-translational modifications, like 2895 Signal peptidase I activity in M pneumoniae Fig SIGNAL P predicted and experimentally verified cleavage site for P40 ... N-terminal part of the peptide, it is evident that the N-terminal amino acid is asparagine (position 26), but increased in mass by 136 Da Because this modification is only possible at the free a amino ... although a SPase I activity has been shown to be essential for cell viability in all bacteria analyzed [26] To test experimentally whether there is a type I SPase activity in M pneumoniae, we determined...
  • 9
  • 179
  • 0

Báo cáo khoa học: The benzophenanthridine alkaloid sanguinarine perturbs microtubule assembly dynamics through tubulin binding A possible mechanism for its antiproliferative activity Manu Lopus and Dulal Panda docx

Báo cáo khoa học: The benzophenanthridine alkaloid sanguinarine perturbs microtubule assembly dynamics through tubulin binding A possible mechanism for its antiproliferative activity Manu Lopus and Dulal Panda docx
... (13-methyl-[1,3]-benzodioxolo[5,6-c]1,3-dioxolo-[4,5-i]-phenanthridinium chloride) (Fig 1), a benzophenanthridine alkaloid derived from the plant Sanguinaria canadensis, has been shown to have antimicrobial, anti-inflammatory, antioxidant, and anticancer ... sanguinarine on the assembly of pure tubulin, the alkaloid inhibited the rate and extent of the assembly of microtubule protein, as measured by light scattering (Fig 5D) For example, 20 lm sanguinarine ... used the amount of sanguinarine precipitated at each concentration of sanguinarine in the presence of BSA as a background to correct the experimental data Effects of sanguinarine on tubulin ANS...
  • 12
  • 137
  • 0

Báo cáo khoa học: Catalytically active membrane-distal phosphatase domain of receptor protein-tyrosine phosphatase a is required for Src activation doc

Báo cáo khoa học: Catalytically active membrane-distal phosphatase domain of receptor protein-tyrosine phosphatase a is required for Src activation doc
... the membrane-distal domain of RPTPa affected the biological function of RPTPa, impairing Src binding and its ability to activate Src Our results indicate that a catalytically active D2 domain is ... that the catalytic activity of RPTPa-D2 plays an important role in Src activation To confirm that the catalytic activity of RPTPa-D2 is required for Src binding and activation, we used an RPTPa-D2 ... pTyr527 and activate Src Taken together, these results indicate that catalytically active RPTPa-D2 is required for binding and activation of Src Discussion Here we report that inactivating mutations...
  • 9
  • 97
  • 0

Báo cáo khoa học: Ki-1⁄57 interacts with PRMT1 and is a substrate for arginine methylation pptx

Báo cáo khoa học: Ki-1⁄57 interacts with PRMT1 and is a substrate for arginine methylation pptx
... Functional association of Ki-1 ⁄ 57 and PRMT1 D O Passos et al Preparation of cytoplasmic and nuclear extracts, methylation assays with cellular Ki-1 ⁄ 57 and metabolic labeling Carlos H I Ramos and ... 57 interacts with RACK1 and is a substrate for the phosphorylation by phorbol 12-myristate 13-acetate activated protein kinase C J Biol Chem 279, 11444–11455 12 Ozaki T, Watanabe K-I, Nakagawa ... Identification and characterization of two putative human arginine methyltransferases (HRMT1L1 and HRMT1L2) Genomics 48, 330–340 Yanagida M, Hayano T, Yamauchi Y, Shinkawa T, Natsume T, Isobe T & Takahashi...
  • 16
  • 141
  • 0

Báo cáo khoa học: EmbR, a regulatory protein with ATPase activity, is a substrate of multiple serine⁄threonine kinases and phosphatase in Mycobacterium tuberculosis doc

Báo cáo khoa học: EmbR, a regulatory protein with ATPase activity, is a substrate of multiple serine⁄threonine kinases and phosphatase in Mycobacterium tuberculosis doc
... ethambutol Nat Med 3, 567–570 30 Amemura M, Makino K, Shinagawa H & Nakata A (1990) Cross talk to the phosphate regulon of Escherichia coli by PhoM protein: PhoM is a histidine protein kinase and catalyzes ... kinases PknF and PknG of Mycobacterium tuberculosis: characterization and localization Microbiology 147, 2307–2314 12 Gopalaswamy R, Narayanan PR & Narayanan S (2004) Cloning, overexpression, and ... heat-inactivated Mstp) in phosphatase buffer Incubation with Mstp resulted in 73% and 79% dephospho- Autoradiogram Autoradiogram Phosphorylated forms of PknH and EmbR are substrates of Mstp in...
  • 11
  • 151
  • 0

Báo cáo khoa học: The N-terminal cysteine pair of yeast sulfhydryl oxidase Erv1p is essential for in vivo activity and interacts with the primary redox centre doc

Báo cáo khoa học: The N-terminal cysteine pair of yeast sulfhydryl oxidase Erv1p is essential for in vivo activity and interacts with the primary redox centre doc
... six cysteines in yeast Erv1p was the major goal of this paper All three pairs of cysteines in Erv1p are indispensable for in vivo activity The six cysteines of yeast Erv1p can be grouped into ... any activity in vitro or in vivo This phenotype is in agreement with the finding that the C130–C133 pair is part of the primary redox- active centre Cysteine 159 and 176 stabilize the FAD-binding ... domain The second pair of cysteines in the crystallized part of Erv2p is separated by 17 residues and the exact distance is found between the corresponding cysteines of Erv1p The reason for this...
  • 8
  • 140
  • 0

Báo cáo khóa học: Modified colorimetric assay for uricase activity and a screen for mutant Bacillus subtilis uricase genes following StEP mutagenesis pptx

Báo cáo khóa học: Modified colorimetric assay for uricase activity and a screen for mutant Bacillus subtilis uricase genes following StEP mutagenesis pptx
... mutants, designated B4 and B8, had uricase activity Analyzing the motif sequence of mutant uricase Two active variants (B4 and B8) were analyzed by sequence analysis and found to have identical nucleotide ... chromatography of purification and an activity assay by spectrophotometry We have demonstrated the usefulness of this assay and used it to screen for a mutant uricase enzyme The StEP recombination ... that both wild-type and mutant uricase are at optimal activity at pH values from to 10 (Fig 9) Discussion This study describes a modified colorimetric assay for uric acid in which uricase catalyzes...
  • 7
  • 129
  • 1

Báo cáo khoa học: The transmembrane domain of subunitbof theEscherichia coli F1FOATP synthase is sufficient for H + -translocating activity together with subunitsaandc doc

Báo cáo khoa học: The transmembrane domain of subunitbof theEscherichia coli F1FOATP synthase is sufficient for H + -translocating activity together with subunitsaandc doc
... based on the amino acid analysis performed during the synthesis of b1)34 and calibrated with the FO sample assuming a stoichiometry of ab2c10 Dialysis was carried out for 40 h at °C changing the buffer ... studies dealing with the reconstitution of chloroform/methanol extracted subunit c revealed the necessity for the addition of detergent to the sample prior to the removal of the solvent by evaporation ... reconstitution of chloroform/methanol-extracted subunit c also revealed the necessity of an excess of the polypetide, which is also present in chloroform/methanol /H2 O prior to reconstitution [13] This points...
  • 7
  • 79
  • 0

Báo cáo Y học: Proteolytic action of duodenase is required to induce DNA synthesis in pulmonary artery fibroblasts A role for phosphoinositide 3-kinase pot

Báo cáo Y học: Proteolytic action of duodenase is required to induce DNA synthesis in pulmonary artery fibroblasts A role for phosphoinositide 3-kinase pot
... summary, this study has demonstrated that duodenase induces DNA synthesis in pulmonary artery fibroblasts and that this response may be mediated by an atypical PAR, either an isoform of PAR2 or an unidentified ... Isolation and culture of bovine pulmonary artery fibroblasts Sections of proximal bovine pulmonary artery were obtained from the local abattoir and pulmonary artery fibroblasts isolated using a ... signalling targets have not been fully established [12] In this study we have investigated the ability of duodenase to induce DNA synthesis in bovine pulmonary artery fibroblasts, attempting to...
  • 10
  • 187
  • 0

Báo cáo Y học: ik3-1/Cables is a substrate for cyclin-dependent kinase 3 (cdk 3) pdf

Báo cáo Y học: ik3-1/Cables is a substrate for cyclin-dependent kinase 3 (cdk 3) pdf
... residue is also phosphorylated by both cdk3/cyclin A and cdk3/E in vivo (Fig 5) Analysis of ik3-1 amino-acid sequence indicates that ik3-1 has a putative ZRXL (Z and X are typically basic) motif that ... previously [11] To replace Ser274 in ik3-1 cDNA with Thr or Ala, mutagenic primers, 50 -TCTCCGGAGATGTCGAACACT CTCAGGTACTCCCAGACCA -30 or 50 -TCTCCGGAGAT GTCGAACACTCTCAGGTGCTCCCAGACCA -30 (corresponding ... that cyclin/ cdk3 actually phosphorylates ik3-1 P70ik3-1 is phosphorylated by either cyclin A/ cdk3 or cyclin E/cdk3 in vivo Furthermore, to examine whether p70ik3-1 is also phosphorylated by...
  • 7
  • 145
  • 0

Information security audit (IS audit) - A guideline for IS audits based on IT-Grundschutz pptx

Information security audit (IS audit) - A guideline for IS audits based on IT-Grundschutz pptx
... German Institute of Internal Auditors (IIR), the Information System Audit and Control Association (ISACA), and international organisations such as the International Auditing and Assurance Standards ... cross-cutting audits and IS partial audits An IS cross-cutting audit has a holistic approach and a wide range of tests and examinations In an IS cross-cutting audit, all layers of the IT-Grundschutz concept ... focuses on these specifications in particular 1.4 Application This guide for an information security audit on the basis of IT-Grundschutz is a module for implementing the ”National Plan for Information...
  • 38
  • 200
  • 0

Báo cáo khoa học: Helicobacter pylori neutrophil-activating protein activates neutrophils by its C-terminal region even without dodecamer formation, which is a prerequisite for DNA protection – novel approaches against Helicobacter pylori inflammation ppt

Báo cáo khoa học: Helicobacter pylori neutrophil-activating protein activates neutrophils by its C-terminal region even without dodecamer formation, which is a prerequisite for DNA protection – novel approaches against Helicobacter pylori inflammation ppt
... 5¢-GGTGCCTTTCACA TTCCACGCGAAGTTATGCACTTTCAT-3¢, 5¢-AATTTC TTCAGTGGCTTTCGCCACATTGAAAAAATCGGT-3¢, 5¢-GATCCTTTCAGCGAGATCCGCAAACATGTCCGC AAACTC-3¢ and 5¢-TTGCAGCATCCAAATGGACGCTT GCAACTTGGCCAATTG-3¢ for H2 5A, ... TTCCATATGAAAACATTTGAAATT-3¢) and HPNAP_ low (5¢-GCGGGATCCTTAAGCCAAATGGGCTTG-3¢), HPNAP_up (5¢-GCGGAATTCCATATGAAAACATTTG AAATT-3¢) and HPNAP_low (5¢-CCGCTCGAGAGCC AAATGGG-3¢), for pET1 1a and pET29c, respectively ... lane (iron and DNA) and lane (DNA and HP-NAP) correspond to mixtures incubated for 60 Lane (iron and DNA) and lane (DNA and HP-NAP) correspond to 90 min, and lane (iron and DNA) and lane (DNA...
  • 16
  • 147
  • 0

Xem thêm

Từ khóa: Trang trại của bé (giúp trẻ mẫu giáo 5 6 tuổi củng cố số lượng)Phát triển nguồn nhân lực trong các doanh nghiệp nhỏ và vừa ngành may ở tỉnh Hưng Yên đến năm 2020 (LV thạc sĩ))Giải pháp phát triển nguồn lao động nông thôn Hà Nội trong thời kì công nghiệp hóa và hiện đại hóa (LV thạc sĩ))bài32: Nội năng và sự biến thiên nội năngVai trò của cái bi trong giáo dục thẩm mỹ (LA tiến sĩ)Đảng bộ tỉnh Hải Dương lónh đạo chuyển dịch cơ cấu kinh tế nông nghiệp theo hướng công nghiệp hóa, hiện đại hóa từ 1997 đến 2004Phát huy tính tích cực học tập của học sinh trong giờ Ngữ văn 6 bằng cách dùng tranh minh họaNghiên cứu môi trường tái sinh cây dừa cạn (catharanthus roseus (l ) g don) phục vụ chuyển genNghiên cứu luật kết hợp và ứng dụng trong bài toán xây dựng hệ hỗ trợ học sinh trung học phổ thôngSmart lecture room for smart campus building automation systemĐề tài cấp Bộ Nghiên cứu thị trường - Marketing trong xuất khẩu chèĐề tài Đánh giá hiệu quả kinh tế sản xuất cà phê của nông hộ tại xã Hòa Thắng, thành phố Buôn Ma Thuột, tỉnh Đắk LắkĐề tài khoa học cấp bộ Xây dựng vành đai kinh tế Vịnh Bắc Bộ trong tiến trình hình thành khu vực tự do thương mại ASEAN - Trung QuốcĐề tài khoa học Mối quan hệ giữa phạm vi bảo hiểm tiền gửi, cơ cấu sở hữu đến sự chấp nhận rủi ro của các ngân hàng thương mại Việt NamTruyên tranh 7 viên ngọc rồng tập 11Truyên tranh 7 viên ngọc rồng tập 2Hoàn thiện đánh giá thực hiện công việc tại công ty TNHH Mizuho Precision Việt NamTruyên tranh 7 viên ngọc rồng tập 12Truyên tranh 7 viên ngọc rồng tập 13Truyên tranh 7 viên ngọc rồng tập 14
Nạp tiền Tải lên
Đăng ký
Đăng nhập