58744 prompts for a speaking activity 4

An investigation into students’ conversational needs and some suggestions for a speaking syllabus to the 2nd year english bachel

An investigation into students’ conversational needs and some suggestions for a speaking syllabus to the 2nd year english bachel
... designing a syllabus are illustrated as follows Needs analysis-Objectives and aims-Sequencing–Teaching method–Testing and evaluation As a result, analyzing the needs of learners is the first and the foremost ... able to learn the foreign language as a means for close communication and acceptance by people who speak it Learners with instrumental motivation may learn a foreign language for an intermediate ... official and fixed syllabus; on the other hand, the current syllabus seems not satisfied with the students’ conversational needs Thus, analyzing the students’ needs to design an appropriate speaking...
  • 43
  • 164
  • 1

Tài liệu Activity 4.4: Creating a Future-State Usage Scenario pdf

Tài liệu Activity 4.4: Creating a Future-State Usage Scenario pdf
... space to create the future-state use cases Activity 4.4: Creating a Future-State Usage Scenario Exercise 2: Creating a Future-State Usage Scenario (30 minutes) ! Create a future-state usage scenario ... 24 Activity 4.4: Creating a Future-State Usage Scenario Exercise 1: Creating a Future-State Use Case (30 minutes) ! Create a future-state use case Participate in small groups as assigned ... and Bardell, Inc case study Review the current-state use cases and usage scenarios Create future-state use cases for the client billing process by using the current-state use case as a template...
  • 4
  • 189
  • 0

Tài liệu Activity 4.2: Creating a Logical Data Model ppt

Tài liệu Activity 4.2: Creating a Logical Data Model ppt
... actions that define the relationship between each pair of entities, and label the line with the relationship verb This is the initial ER diagram for the logical data model Answer in v04_160 9a_ act42-1.bmp ... v04_160 9a_ act42-1.bmp Activity 4.2: Creating a Logical Data Model Exercise 2: Determining Cardinality and Existence In this exercise, you will use the syntax discussed in the module to identify the cardinality ... 18 Activity 4.2: Creating a Logical Data Model Exercise 1: Identifying Relationships Between Entities In this exercise, you will identify all the relationships between the entities defined in Activity...
  • 4
  • 144
  • 0

Tài liệu Academic Writing A Handbook for International Students part 4 pdf

Tài liệu Academic Writing A Handbook for International Students part 4 pdf
... several areas of academic work, but this unit focuses on using paraphrasing in note-making and summary writing Effective paraphrasing is vital in academic writing to avoid the risk of plagiarism Although ... coast of China could be paraphrased: Remains of an ancient society have been discovered in the sea near China cross-reference 2. 14 3.2 Synonyms Academic Vocabulary A good paraphrase is significantly ... ‘There are so many strains of malaria parasite,’ said one scientist, ‘and each is able to alter its chemical surface and trick its way past the body’s defences We’d need a remarkable vaccine...
  • 10
  • 226
  • 0

Tài liệu ime Control of a Three Phase 4 Wire PWM Inverter with Variable DC Link Voltage and Battery Storage for PV Application doc

Tài liệu ime Control of a Three Phase 4 Wire PWM Inverter with Variable DC Link Voltage and Battery Storage for PV Application doc
... grad r dually as a re esult of the c controllable dc link volta as indica in the ri age ated ight hand sub b diagram d Figure capacitor v voltage of the output filt with unbalanced load and controlled ... small compared to the dc voltage portion, so that it does not affect the output voltage References [1] Takao Kawabata, Takeshi Miyashita and Yushin Yamamoto, "Digital Control of three- Phase Inverter ... Inverter with LC Filter", IEEE Transactions on Power Electronics, Vol 6, No 1, January 1991, pp 62-72 [2] Takao Kawabata, Takeshi Miyashita and Yushin Yamamoto, "Dead Beat Control of threePhase PWM Inverter" ,...
  • 9
  • 219
  • 0

Tài liệu Báo cáo khoa học: Characterization of promoter 3 of the human thromboxane A2 receptor gene A functional AP-1 and octamer motif are required for basal promoter activity docx

Tài liệu Báo cáo khoa học: Characterization of promoter 3 of the human thromboxane A2 receptor gene A functional AP-1 and octamer motif are required for basal promoter activity docx
... Prm3 was performed using the mutator primers Kin175 (5¢-CACCAGAGCTACTTACA CTGAATTCCAGAATAATCACAAGCAAATC -3 ; sense primer) vs its complement generating pGL3b:Prm3aOCT)1*, pGL3b:Prm3abOCT)1* and ... Prm3aaAP)1*, pGL3e:Prm3aaAP)1*, pGL3b:Prm3aaaAP)1* and pGL3e:Prm3aaaAP)1* Mutation of the Oct-1 element with the sequence aaA TGCa to aaTTCCa (core bases shown in uppercase letters) centered at )1 23 within ... Prm3aab; pGL3b:Prm3aab & pGL3e:Prm3aab (Primer Kin160; 5¢-dGAGAGGTACCGCAAATCTTCTCTCGCC TCC -3 , corresponding to NTs )106 to )86) (8) Prm3aaa; pGL3b:Prm3aaa & pGL3e:Prm3aaa (Primer Kin161, 5¢-dGAGAGGTACCGCAGCATCGGCCTGATG...
  • 18
  • 178
  • 0

Tài liệu Báo cáo khoa học: Experimental proof for a signal peptidase I like activity in Mycoplasma pneumoniae, but absence of a gene encoding a conserved bacterial type I SPase pdf

Tài liệu Báo cáo khoa học: Experimental proof for a signal peptidase I like activity in Mycoplasma pneumoniae, but absence of a gene encoding a conserved bacterial type I SPase pdf
... protein, additional information about post-translational modifications, like 2895 Signal peptidase I activity in M pneumoniae Fig SIGNAL P predicted and experimentally verified cleavage site for P40 ... N-terminal part of the peptide, it is evident that the N-terminal amino acid is asparagine (position 26), but increased in mass by 136 Da Because this modification is only possible at the free a amino ... although a SPase I activity has been shown to be essential for cell viability in all bacteria analyzed [26] To test experimentally whether there is a type I SPase activity in M pneumoniae, we determined...
  • 9
  • 179
  • 0

Báo cáo khoa học: The benzophenanthridine alkaloid sanguinarine perturbs microtubule assembly dynamics through tubulin binding A possible mechanism for its antiproliferative activity Manu Lopus and Dulal Panda docx

Báo cáo khoa học: The benzophenanthridine alkaloid sanguinarine perturbs microtubule assembly dynamics through tubulin binding A possible mechanism for its antiproliferative activity Manu Lopus and Dulal Panda docx
... (13-methyl-[1,3]-benzodioxolo[5,6-c]1,3-dioxolo-[4,5-i]-phenanthridinium chloride) (Fig 1), a benzophenanthridine alkaloid derived from the plant Sanguinaria canadensis, has been shown to have antimicrobial, anti-inflammatory, antioxidant, and anticancer ... sanguinarine on the assembly of pure tubulin, the alkaloid inhibited the rate and extent of the assembly of microtubule protein, as measured by light scattering (Fig 5D) For example, 20 lm sanguinarine ... used the amount of sanguinarine precipitated at each concentration of sanguinarine in the presence of BSA as a background to correct the experimental data Effects of sanguinarine on tubulin ANS...
  • 12
  • 137
  • 0

Xem thêm

Từ khóa: thực trạng chiến lược phát triển ngân hàngTHỰC TRẠNG CHÍNH SÁCH CỔ TỨC TẠI CÁC CÔNG TY NGÀNH THỦY SẢN NIÊM YẾT TRÊN SỞ GIAO DỊCH CHỨNG KHOÁN THÀNH PHỐ HỒ CHÍ MINHthực trạng chính sách phát triên kinh tế ven biểnthực trạng đầu tư phát triển kinh tế thủ đô viêng chănThực trạng hiện nay và phương hướng đào tạo công nhân lành nghề cho các khu công nghiệp Đồng Nai đến năm 2010thực trạng hoạt động cho thuế tài chính ở việt nam hiện nayGIÁO TRÌNH GIÁO DỤC CHÍNH TRỊ TCCNSỒ TAY QUẢN LÝ TÀI CHÍNHNghiên cứu một số chỉ số hình thái thể lực và trí tuệ của học sinh trường THPT trần quốc tuấn, huyện hải hậu, tỉnh nam địnhluận văn thạc sĩ Khảo sát các tín hiệu thẩm mĩ “mùa xuân” và “trái tim” trong thơ Xuân DiệuLuận văn Thạc sĩ khoa học Lâm nghiệp Đánh giá năng lực hấp thụ CO2 của rừng thường xanh làm cơ sở xây dựng chính sách về dịch vụ môi trường tại tỉnh Dăk NôngPhát triển ngành trồng trọt theo hướng bền vững tại tỉnh nam định giai đoạn 2015 2020SKKN quản lý: Một số giải pháp chỉ đạo rèn kĩ năng sống cho học sinh trong trường tiểu họcCác biện pháp phòng vệ thương mại theo hiệp định thương mại tự do (LA tiến sĩ)PHONG TRÀO CHẤN HƯNG PHẬT GIÁO ở MIỀN TRUNG VIỆT NAM (1932 1951)Nâng cao chất lượng nguồn nhân lực quản lý trong các doanh nghiệp nhỏ và vừa của thành phố tuyên quangXây dựng phân hệ kế toán tài sản cố định hữu hình tại công ty TNHH MTV vận tải đường sắt hà nội chi nhánh vận tải đường sắt hải phòngXây dựng phân hệ kế toán tiền mặt tại công ty cổ phần đầu tư xây dựng và TM việt nhật – hà nộiBí quyết để có một kỳ nghỉ dài, y như nghỉ tết âm lịch lần 2Xác định sự phân bố và một số đặc điểm sinh học phân tử các nhóm escherichia coli gây tiêu chảy ở trẻ em dưới 5 tuổi tại địa bàn hà nội
Nạp tiền Tải lên
Đăng ký
Đăng nhập