58744 prompts for a speaking activity 4

An investigation into students’ conversational needs and some suggestions for a speaking syllabus to the 2nd year english bachel

An investigation into students’ conversational needs and some suggestions for a speaking syllabus to the 2nd year english bachel
... designing a syllabus are illustrated as follows Needs analysis-Objectives and aims-Sequencing–Teaching method–Testing and evaluation As a result, analyzing the needs of learners is the first and the foremost ... able to learn the foreign language as a means for close communication and acceptance by people who speak it Learners with instrumental motivation may learn a foreign language for an intermediate ... official and fixed syllabus; on the other hand, the current syllabus seems not satisfied with the students’ conversational needs Thus, analyzing the students’ needs to design an appropriate speaking...
  • 43
  • 177
  • 1

Tài liệu Activity 4.4: Creating a Future-State Usage Scenario pdf

Tài liệu Activity 4.4: Creating a Future-State Usage Scenario pdf
... space to create the future-state use cases Activity 4.4: Creating a Future-State Usage Scenario Exercise 2: Creating a Future-State Usage Scenario (30 minutes) ! Create a future-state usage scenario ... 24 Activity 4.4: Creating a Future-State Usage Scenario Exercise 1: Creating a Future-State Use Case (30 minutes) ! Create a future-state use case Participate in small groups as assigned ... and Bardell, Inc case study Review the current-state use cases and usage scenarios Create future-state use cases for the client billing process by using the current-state use case as a template...
  • 4
  • 202
  • 0

Tài liệu Activity 4.2: Creating a Logical Data Model ppt

Tài liệu Activity 4.2: Creating a Logical Data Model ppt
... actions that define the relationship between each pair of entities, and label the line with the relationship verb This is the initial ER diagram for the logical data model Answer in v04_160 9a_ act42-1.bmp ... v04_160 9a_ act42-1.bmp Activity 4.2: Creating a Logical Data Model Exercise 2: Determining Cardinality and Existence In this exercise, you will use the syntax discussed in the module to identify the cardinality ... 18 Activity 4.2: Creating a Logical Data Model Exercise 1: Identifying Relationships Between Entities In this exercise, you will identify all the relationships between the entities defined in Activity...
  • 4
  • 152
  • 0

Tài liệu Academic Writing A Handbook for International Students part 4 pdf

Tài liệu Academic Writing A Handbook for International Students part 4 pdf
... several areas of academic work, but this unit focuses on using paraphrasing in note-making and summary writing Effective paraphrasing is vital in academic writing to avoid the risk of plagiarism Although ... coast of China could be paraphrased: Remains of an ancient society have been discovered in the sea near China cross-reference 2. 14 3.2 Synonyms Academic Vocabulary A good paraphrase is significantly ... ‘There are so many strains of malaria parasite,’ said one scientist, ‘and each is able to alter its chemical surface and trick its way past the body’s defences We’d need a remarkable vaccine...
  • 10
  • 251
  • 0

Tài liệu ime Control of a Three Phase 4 Wire PWM Inverter with Variable DC Link Voltage and Battery Storage for PV Application doc

Tài liệu ime Control of a Three Phase 4 Wire PWM Inverter with Variable DC Link Voltage and Battery Storage for PV Application doc
... grad r dually as a re esult of the c controllable dc link volta as indica in the ri age ated ight hand sub b diagram d Figure capacitor v voltage of the output filt with unbalanced load and controlled ... small compared to the dc voltage portion, so that it does not affect the output voltage References [1] Takao Kawabata, Takeshi Miyashita and Yushin Yamamoto, "Digital Control of three- Phase Inverter ... Inverter with LC Filter", IEEE Transactions on Power Electronics, Vol 6, No 1, January 1991, pp 62-72 [2] Takao Kawabata, Takeshi Miyashita and Yushin Yamamoto, "Dead Beat Control of threePhase PWM Inverter" ,...
  • 9
  • 226
  • 0

Tài liệu Báo cáo khoa học: Characterization of promoter 3 of the human thromboxane A2 receptor gene A functional AP-1 and octamer motif are required for basal promoter activity docx

Tài liệu Báo cáo khoa học: Characterization of promoter 3 of the human thromboxane A2 receptor gene A functional AP-1 and octamer motif are required for basal promoter activity docx
... Prm3 was performed using the mutator primers Kin175 (5¢-CACCAGAGCTACTTACA CTGAATTCCAGAATAATCACAAGCAAATC -3 ; sense primer) vs its complement generating pGL3b:Prm3aOCT)1*, pGL3b:Prm3abOCT)1* and ... Prm3aaAP)1*, pGL3e:Prm3aaAP)1*, pGL3b:Prm3aaaAP)1* and pGL3e:Prm3aaaAP)1* Mutation of the Oct-1 element with the sequence aaA TGCa to aaTTCCa (core bases shown in uppercase letters) centered at )1 23 within ... Prm3aab; pGL3b:Prm3aab & pGL3e:Prm3aab (Primer Kin160; 5¢-dGAGAGGTACCGCAAATCTTCTCTCGCC TCC -3 , corresponding to NTs )106 to )86) (8) Prm3aaa; pGL3b:Prm3aaa & pGL3e:Prm3aaa (Primer Kin161, 5¢-dGAGAGGTACCGCAGCATCGGCCTGATG...
  • 18
  • 186
  • 0

Tài liệu Báo cáo khoa học: Experimental proof for a signal peptidase I like activity in Mycoplasma pneumoniae, but absence of a gene encoding a conserved bacterial type I SPase pdf

Tài liệu Báo cáo khoa học: Experimental proof for a signal peptidase I like activity in Mycoplasma pneumoniae, but absence of a gene encoding a conserved bacterial type I SPase pdf
... protein, additional information about post-translational modifications, like 2895 Signal peptidase I activity in M pneumoniae Fig SIGNAL P predicted and experimentally verified cleavage site for P40 ... N-terminal part of the peptide, it is evident that the N-terminal amino acid is asparagine (position 26), but increased in mass by 136 Da Because this modification is only possible at the free a amino ... although a SPase I activity has been shown to be essential for cell viability in all bacteria analyzed [26] To test experimentally whether there is a type I SPase activity in M pneumoniae, we determined...
  • 9
  • 201
  • 0

Báo cáo khoa học: The benzophenanthridine alkaloid sanguinarine perturbs microtubule assembly dynamics through tubulin binding A possible mechanism for its antiproliferative activity Manu Lopus and Dulal Panda docx

Báo cáo khoa học: The benzophenanthridine alkaloid sanguinarine perturbs microtubule assembly dynamics through tubulin binding A possible mechanism for its antiproliferative activity Manu Lopus and Dulal Panda docx
... (13-methyl-[1,3]-benzodioxolo[5,6-c]1,3-dioxolo-[4,5-i]-phenanthridinium chloride) (Fig 1), a benzophenanthridine alkaloid derived from the plant Sanguinaria canadensis, has been shown to have antimicrobial, anti-inflammatory, antioxidant, and anticancer ... sanguinarine on the assembly of pure tubulin, the alkaloid inhibited the rate and extent of the assembly of microtubule protein, as measured by light scattering (Fig 5D) For example, 20 lm sanguinarine ... used the amount of sanguinarine precipitated at each concentration of sanguinarine in the presence of BSA as a background to correct the experimental data Effects of sanguinarine on tubulin ANS...
  • 12
  • 143
  • 0

Xem thêm

Từ khóa: Hạn chế rủi ro tín dụng trong cho vay hộ kinh doanh tại Ngân hàng TMCP Đông Nam Á - Chi nhánh Đà NẵnHoạch định chiến lược kinh doanh của Công ty Cổ phần Mía Đường ĐăkNôngHoàn thiện công tác kế toán ở các đơn vị sự nghiệp thuộc Sở Tư pháp tỉnh Quảng NaHoàn thiện công tác quản lý chi ngân sách nhà nước huyện Quảng Ninh, tỉnh Quảng BìnHoàn thiện hoạt động thanh tra tại chỗ đối với các tổ chức tín dụng của Ngân hàng Nhà nước Việt Nam chi nhánh thành phố Đà NẵnHoàn thiện kiểm soát nội bộ chu trình bán hàng và thu tiền tại Công ty Cổ phần Than Điện Nông SơnKế toán quản trị chi phí môi trường trong các doanh nghiệp chế biến dầu khí thuộc Tập đoàn Dầu khí Quốc gia Việt NamKế toán quản trị chi phí sản xuất tại Công ty Cổ phần Xuất nhập khẩu Thủy sản miền TrunKế toán quản trị môi trường tại Công ty Cổ phần Xi măng VICEM Hải VâKế toán trách nhiệm tại Công ty Cổ phần Lương thực Đà NẵnMở rộng cho vay doanh nghiệp tại Ngân hàng Thương mại Cổ phần Đông Á, chi nhánh Thừa Thiên HuMở rộng cho vay khách hàng cá nhân tại chi nhánh Ngân hàng TMCP Á Châu Đăk LăkMột số phương pháp số giải bài toán quy hoạch phi tuyến có ràng buộcNghiên cứu các chủng vi khuẩn Bacillus có khả năng phân giải hợp chất hữu cơ nhằm ứng dụng trong xử lý nước thải từ khu công nghiệp dịch vụ thủy sản Thọ Quang, Đà NẵngNghiên cứu các nhân tố ảnh hưởng đến hành vi mua xe máy trường hợp tại thành phố Đà NẵnNghiên cứu các nhân tố ảnh hưởng đến mức độ công bố thông tin trong báo cáo tài chính của các doanh nghiệp thuộc nhóm ngành vận tải niêm yết trên thị trường chứng khoán Việt NamNghiên cứu các yếu tố ảnh hưởng đến ý định sử dụng dịch vụ mua hàng điện tử qua mạng của người tiêu dùng tại thành phố Đà NẵnNghiên cứu các yếu tố tác động đến ý định mua iphone của người tiêu dùng tại Đà NẵngNghiên cứu sự chấp nhận và sử dụng dịch vụ internet banking của khách hàng cá nhân trên địa bàn thành phố HuếNghiên cứu sự hài lòng của công dân đối với dịch vụ hành chính công về lĩnh vực nhà đất tại UBND quận Cẩm Lệ, thành phố Đà Nẵng
Nạp tiền Tải lên
Đăng ký
Đăng nhập