catching a cold

Báo cáo khoa học: Suppression of a cold-sensitive mutant initiation factor 1 by alterations in the 23S rRNA maturation region pdf

Báo cáo khoa học: Suppression of a cold-sensitive mutant initiation factor 1 by alterations in the 23S rRNA maturation region pdf
... mutations that are located in the 23S rRNA processing stem (Fig 1) This structural region is subject to cleavage by RNase III and other ribonucleases during 23S rRNA maturation [16 ] In particular, ... sensitivity of mutant IF1 As we had established that processing defects in 23S rRNA act as suppressors of a cold-sensitive IF1 mutant, we reasoned that other similar defects in 50S maturation as a whole ... CGCGGATCAGGTGGGGATGTATTA; rnc5¢I comp, GGCAGTGGATGATGGGGTTCATGCGATACC; rnc3¢O SalI, TGCGTCGACATTTGCCGCAATAGTGTCAACA; and rnc3¢I comp, TGAACCCCATCATCCACTGCCAG GTCAGCG The deletion was constructed in...
  • 12
  • 203
  • 0

Báo cáo khoa học: Structural features and dynamics of a cold-adapted alkaline phosphatase studied by EPR spectroscopy docx

Báo cáo khoa học: Structural features and dynamics of a cold-adapted alkaline phosphatase studied by EPR spectroscopy docx
... standard assay and EPR spectra of the spin-labeled WT AP were measured after incubation in urea The scaled mobility factor (Ms) was calculated from the central linewidth of the EPR spectra packs ... these areas We also chose to place The activity and stability of the Vibrio AP was measured for each mutation, before and after spinlabeling Furthermore, the activity and stability of the spin-labeled ... of 12 A We demonstrate that EPR spectra of spin-labeled variants can be used to extract information on local dynamics of the various secondary backbone structures and some tertiary interactions...
  • 11
  • 79
  • 0

Báo cáo khoa học: Crystal structure of a cold-adapted class C b-lactamase potx

Báo cáo khoa học: Crystal structure of a cold-adapted class C b-lactamase potx
... Psychrophilic class C b-lactamase C Michaux et al classes A, C and D are active site serine enzymes, whereas class B b-lactamases require one or two zinc ions for their activity [1] Only class C ... hydrophobic contacts and aromatic interactions are similar in all enzymes Frequently, alterations of the accessible surface of nonpolar side chains and of the accessible charged surfaces are observed ... Grenoble, France) on a MarResearch CCD Data processing, molecular replacement and refinement of Pse fluorescens TAE4 b-lactamase Data were processed with the hkl suite package [45] A molecular replacement...
  • 11
  • 93
  • 0

Narrowband photon pairs from a cold atomic vapour for interfacing with a single atom

Narrowband photon pairs from a cold atomic vapour for interfacing with a single atom
... work with him and Sandako while doing HOM measurements Gleb, for always teasing me I still miss that Dzmitry, for his great ideas One can approach him anytime and any day and he is always ready ... residual pump light The pump beams can be adjusted to any value from a linear to circular polarization using Polarizers (P), quarter wave plates (q) A pair of quarter wave plates (q), half wave plates ... the case in a initial atomic beam experiments [48] which had only a very small number of atoms participating in the excitation and decay process at any time A spatially extended atomic ensemble,...
  • 124
  • 52
  • 0

Quantum interference between single photons from a single atom and a cold atomic ensemble

Quantum interference between single photons from a single atom and a cold atomic ensemble
... To trap a single atom, we start with an atomic cloud in a magneto-optical trap (MOT) and use an optical dipole trap to trap a single atom at the focus of the lens1 A MOT consists of three pairs ... my stay enjoyable To all my family members, especially my parents, that are always there and have always cared for me No words can express my gratitude to all of you At last, many thanks to all ... generation from the atomic ensemble 2.2 Single Photon from Single Atom Single photon generation from a single atom in cavity has been previously demonstrated for Rb [38, 39, 40, 41] and Cs [42] Basically,...
  • 90
  • 112
  • 0

who catches a cold when emerging Markets sneeze

who catches a cold when emerging Markets sneeze
... Zambia) and 41 other developing countries Frontier markets Advanced markets Brazil Morocco Argentina Ghana Panama Australia Ireland Chile Pakistan Azerbaijan Guatemala Paraguay Austria Iceland ... each region EAP = East Asia and Pacific; ECA = Europe and Central Asia; LAC = Latin America and the Caribbean; MNA = Middle East and North Africa; SAR = South Asia; SSA = Sub-Saharan Africa Emerging ... Ecuador, El Salvador, Gabon, Ghana, Guatemala, Honduras, Jamaica, Jordan, Kenya, Mauritius, Nigeria, Panama, Paraguay, Senegal, Sri Lanka, Tunisia, Uruguay, República Bolivariana de Venezuela,...
  • 40
  • 93
  • 0

Tài liệu Báo cáo khóa học: A multi-protein complex containing cold shock domain (Y-box) and polypyrimidine tract binding proteins forms on the vascular endothelial growth factor mRNA Potential role in mRNA stabilization pptx

Tài liệu Báo cáo khóa học: A multi-protein complex containing cold shock domain (Y-box) and polypyrimidine tract binding proteins forms on the vascular endothelial growth factor mRNA Potential role in mRNA stabilization pptx
... on the 5¢-UTR The single-strand RNA and DNA binding, cold shock domain (CSD) (also known as Y-box) proteins, play diverse roles in both transcriptional and post-transcriptional regulation of growth ... that CSD proteins form a cytoplasmic complex on VEGF mRNA that also contains the multifunctional singlestrand RNA/DNA binding protein, PTB [43–46,52–57], and that the binding of this complex may ... and IRES-driven translation [43–46] it is possible that the CSD/PTB sites play a role in translation as well as stabilization of the VEGF mRNA A combined role in mRNA stability and translation...
  • 13
  • 252
  • 0

Tài liệu Báo cáo khoa học: Crystal structure of a subtilisin-like serine proteinase from a psychrotrophic Vibrio species reveals structural aspects of cold adaptation docx

Tài liệu Báo cáo khoa học: Crystal structure of a subtilisin-like serine proteinase from a psychrotrophic Vibrio species reveals structural aspects of cold adaptation docx
... of cold adaptation ase structure, the first structure of a cold- adapted subtilase to be determined, enables a more focused examination of plausible determinants of different temperature adaptation ... Number of ion pairsa Number of hydrogen bonds Main chain–main chain Main chain–side chain Side chain–side chain Total ˚ Exposed surface areab (A2 ) ˚ Apolarc (A2 ) ˚ Buried surface areab (A2 ) ˚ Apolarc ... uracil–DNA glycosylase from Atlantic cod (Gadus morhua) reveals cold- adaptation features Acta Crystallogr Sect D 59, 1357–1365 10 Aghajari N, Van Petegem F, Villeret V, Chessa JP, Gerday C, Haser...
  • 14
  • 190
  • 0

Tài liệu Báo cáo khoa học: A single amino acid substitution of Leu130Ile in snake DNases I contributes to the acquisition of thermal stability A clue to the molecular evolutionary mechanism from cold-blooded to warm-blooded vertebrates docx

Tài liệu Báo cáo khoa học: A single amino acid substitution of Leu130Ile in snake DNases I contributes to the acquisition of thermal stability A clue to the molecular evolutionary mechanism from cold-blooded to warm-blooded vertebrates docx
... substitution mutant snake DNases I The thermal stabilities of the wild-type and mutant enzymes of the snakes were examined by measuring the activities remaining after incubation for 40 at various ... mechanism of generating a thermally stable enzyme form from a thermally unstable one: frog, toad and newt DNases I all have a Ser205 insertion in a domain that contains an essential Ca2+binding ... factor in the initiation of human and rat SLE [12,40], the acquisition of thermally stable characteristics during DNase I evolution may provide a clue to the etiology of SLE in humans and mice,...
  • 8
  • 190
  • 0

Tài liệu Báo cáo Y học: Exploring the role of a glycine cluster in cold adaptation of an alkaline phosphatase pdf

Tài liệu Báo cáo Y học: Exploring the role of a glycine cluster in cold adaptation of an alkaline phosphatase pdf
... 5¢-d(TCAGAAATTAAAGCGG ATGCATTATTTGCATG)-3¢ The upstream primer containing the NdeI restriction site (underlined) was: 5¢-d(GCTAGCATATGAAGCTTAAA AAAATTG)-3¢ and the downstream primer containing the ... value almost 2.5-fold higher than the native cold adapted enzyme (Table 1) The mutant G26 1A /Y2 6 9A exhibits an Ea almost the same as in the case of the native enzyme (Table 1) Thermal inactivation ... dimensional model of the wild type (A) and mutant alkaline phosphatases G26 1A (B) and G26 1A /Y2 6 9A (C); only residues that where studied are shown respectively By introducing an Ala residue in the place...
  • 6
  • 157
  • 0

Cold War Biographies Volume 1: A-J pot

Cold War Biographies Volume 1: A-J pot
... Cold War Biographies Cold War Biographies Volume 1: A-J Sharon M Hanes and Richard C Hanes Lawrence W Baker, Project Editor Cold War: Biographies Sharon M Hanes and ... U•X•L Cold War Reference Library Cold War: Biographies is only one component of the three-part U•X•L Cold War Reference Library The other two titles in this set are: • Cold War: Almanac (two volumes) ... U•X•L Cold War Reference Library is also available Acknowledgments Kelly Rudd and Meghan O’Meara contributed importantly to Cold War: Biographies Special thanks to Catherine xii Cold War: Biographies...
  • 244
  • 149
  • 0

Báo cáo khoa học: Possible involvement of an FKBP family member protein from a psychrotrophic bacterium Shewanella sp. SIB1 in cold-adaptation potx

Báo cáo khoa học: Possible involvement of an FKBP family member protein from a psychrotrophic bacterium Shewanella sp. SIB1 in cold-adaptation potx
... Luria–Bertani medium containing 50 mgÆL)1 ampicillin or 35 mgÆL)1 kanamycin Extraction of soluble proteins from SIB1 Cultures of Shewanella sp strain SIB1 were grown at or 20 °C in 200 mL of medium ... MIPlike FKBP subfamily According to the crystal structure, L pneumophila MIP is composed of a N-terminal domain, that is involved in dimerization of the protein, and a C-terminal catalytic domain ... MIP-like FKBP subfamily proteins, except human FKBP1 2 which is composed of only a C-terminal catalytic domain, have similar 3D structures and are distinguished from other FKBP family proteins in their...
  • 10
  • 147
  • 0

Báo cáo khoa học: Common mode of DNA binding to cold shock domains Crystal structure of hexathymidine bound to the domain-swapped form of a major cold shock protein from Bacillus caldolyticus pot

Báo cáo khoa học: Common mode of DNA binding to cold shock domains Crystal structure of hexathymidine bound to the domain-swapped form of a major cold shock protein from Bacillus caldolyticus pot
... like a ‘C’ character All nucleobases are unstacked with respect to each other The nucleotides are in anti conformation The stereo view is from the protein surface towards DNA strand D The DNA is ... 180° rotations of their main chains at Glu36w, causing the Bc-Csp structures to open up and allowing them to re-associate as domain-swapped dimers Apart from differences in the course of the protein ... even in the folded state of the protein [25] A state similar to that of the open monomer may reflect a substate in the folding pathway of Bc-Csp In such an arrangement, the subdomains may form independently...
  • 15
  • 148
  • 0

Xem thêm

Từ khóa: Phương pháp nghiên cứu tâm lý học tổ chức, công nghiệp, nhân sự Handbook of Research Methods in Industrial and Organizational PsychologyBài dịch bản chất của tài chính doanh nghiệpBài dịch môn tài chính doanh nghiệp chính sách cổ tức và cấu trúc vốnThuyết trình môn tài chính doanh nghiệp các hình thức tài trợ bằng nợThuyết trình môn tài chính doanh nghiệp chính sách cổ tứcThuyết trình môn tài chính doanh nghiệp chính sách nợ có tác động như thế nào đến giá trị doanh nghiệpThuyết trình môn tài chính doanh nghiệp khái quát về tài trợ doanh nghiệpThuyết trình tổng quan tài chính doanh nghiệpChiến lược kinh doanh tại công ty TNHH MTV Nhựa Bình Minh miền BắcĐánh giá hiện trạng và đề xuất giải pháp nâng cao an toàn giao thông tại các đường ngang cắt qua đường sắt ở địa phận thành phố Đà NẵngĐánh giá hiện trạng và đề xuất giải pháp quản lý chất thải rắn y tế nguy hại trên địa bàn thành phố Đà NẵngGiải pháp thiết kế trắc dọc hợp lý đường ôtô cao tốc đoạn KM42 000--KM47+000 đường cao tốc Đà Nẵng - Quảng NgãiHiệu quả sử dụng tài sản tại Công ty TNHH Tiến Đại PhátKiểm soát rủi ro tín dụng cho vay doanh nghiệp vừa và nhỏ tại Ngân hàng TMCP Xuất Nhập khẩu Việt Nam - Chi nhánh Ba ĐìnhMô phỏng nồng độ chất ô nhiễm các công đoạn xử lý nước thải trạm xử lý nước thải KCN Hòa Cầm, đề xuất, cải tiến vận hành để nồng độ đầu ra đạt QCVNMột số giải pháp nhằm nâng cao chất lượng dịch vụ nhà hàng tại khách sạn Xanh - HuếQuản trị quan hệ khách hàng tại Khu nghỉ mát Sandybeach Đà NẵngTiếng Anh dành cho sinh viên Tâm lý học English for students of psychologyLeaders in educational researchBáo cáo thực tập Phân tích thiết kế hệ thống Thiết kế một trang web chia sẻ hình ảnh
Nạp tiền Tải lên
Đăng ký
Đăng nhập