feelings and emotions new matching for young learners

Telling tales in english stories for young learners and how to use them

Telling tales in english stories for young learners   and how to use them
... stories read to them For motivation: stories help children understand by giving language in context and a purpose to learning • For consolidation and extension: stories can be chosen to link with ... story and saying, Point to the money Point to the rich man Point to the cupboard Pupils point to each item in their pairs To make it more fun, the pupil who points to the correct item first in ... pupils to mime the actions as they listen Play the song again and get the class to join in, singing and doing the actions Split the class into groups, and get each group to make up a verse for a...
  • 84
  • 119
  • 0

Flashcards for Kids: Feelings and Emotions

Flashcards for Kids: Feelings and Emotions
... biểu mẫu miễn phí Flash card picturing feelings and emotions like happy, sad, worried, angry, tired, sleepy, thirsty, hungry, sick Feelings and Emotions flashcards showing thoughtful, scared,...
  • 4
  • 46
  • 0

Báo cáo khoa học: "Tense and Aspect Error Correction for ESL Learners Using Global Context" potx

Báo cáo khoa học:
... Tense /Aspect Error Corpus Table 1: Local features for a verb phrase Developing a high-quality tense and aspect error correction system requires a large corpus annotated with tense /aspect errors ... detection and correction performance of each model The figures are grouped by error types: tense, aspect, and both tense and aspect All figures indicate that the CRF model achieves better performance ... having corrections.5 The annotated tense /aspect labels include 12 combinations of tense (past, present, future) and aspect (nothing, perfect, progressive, perfect progressive) Error Correction Using...
  • 5
  • 76
  • 0

Báo cáo khoa học: Proteoglycans in health and disease: new concepts for heparanase function in tumor progression and metastasis pptx

Báo cáo khoa học: Proteoglycans in health and disease: new concepts for heparanase function in tumor progression and metastasis pptx
... Barash et al New concepts for heparanase function B A Fig (A) Immunohistochemical staining of heparanase in squamous cell carcinoma of the head and neck (SCCHN) tumor specimens Formalin-fixed, paraffin-embedded ... multifaceted protein engaged in multiple aspects of tumor progression, combining enzymatic activity-dependent and -independent activities of heparanase and affecting two systems critical for tumor progression, ... [23,25,30,31] and are not discussed in detail here Heparanase in tumor progression and metastasis Enzymatic activity capable of cleaving glucuronidic linkages and releasing polysaccharide chains resistant...
  • 14
  • 120
  • 0

A study on English idioms and proverbs expressing human feelings and emotions

A study on English idioms and proverbs expressing human feelings and emotions
... on human feelings and emotions are presented and analyzed Particularly , I pay attention to collect and analyze idioms and proverbs on human feelings and emotions , such as love, happy, sad, hungry, ... Studies on idioms and proverbs expressing human feelings and emotions Idioms and proverbs relating to feelings and emotions are collected, classified and analyzed Chapter 3: Application of the study: ... graduation paper 2.2 .English idioms and proverbs expressing feelings and emotions: Feelings and emotions are a complicated process taking place in human so idioms and proverbs expressing feelings and...
  • 69
  • 300
  • 5

RBF Neurals Networks and a new algorithm for training RBF networks

RBF Neurals Networks and a new algorithm for training RBF networks
... Bromhead and D Lowe, “Multivariable functional interpolation and adaptive networks , Complex Systems, vol 2, 1988, pp 321-355 J.Park and I.W Sandberg “Approximation and radial-basis-function networks , ... Hoang Xuan Huan , Dang Thi Thu Hien and Huu Tue Huynh, An efficient algorithm for training interpolation RBF networks with equally spaced nodes, IEEE Transaction on neural networks, IEEE Transaction ... method M and function Φ ( x, c1 , c , , ck ) is chosen as linear function RBF NETWORKS AND QHDH TRAINING ALGORITHM RBF networks are networks with layers (2 neural layers) Each neural in hidden layer...
  • 22
  • 86
  • 0

optimization of protein and rna detection methodologies and a new approach for manipulating protein activity in living cells

optimization of protein and rna detection methodologies and a new approach for manipulating protein activity in living cells
... 5’PHOS-GAACCGGAGCCGCAGCACCCGGGGCAGCAAGGCATT 27 GGGAAGCTTGCCACCATGGGTGACTGGAGTGCCTTGGGGAAATTACTGG ACAAGG 28 AAAAGGTACCGACCGGTTGAACCGCAATCTCCAGGTCATCAG 29 ACCATGGCCGGATCCGCTCGGTGGTGCTGCCC 30 GGGCAGCACCACCGAGCGGATCCGGCCATGGT ... TTTTAAGCTTGCCACCATGGCCGGATCCTAAGCGGCCGCAGCAAGGGCGAGGAG CTG 10 CCCCATCGATCTCGAGTTACTTGTACAGCTCGTCCAT 11 ACCTACAGGTGGGGTCTTTCATTCCC 12 AGCTCGTTTAGTGAACCGTCAGATC 13 GACAAGCGGCCGCTTAAGAACCGC 14 AAACTCGAGTTAGCGGCCGCCCCTCCACATGCAG 15 AAAGCGGCCGCCAGAACCGCAGCACCCGGGGCA ... TTTAAGCTTGCCACCATGGATTACAAGGATGACGACGATAAGGGATCCGCCGGAT CCTTTTTGAATTG 32 Table 1.2 Continued 21 TTTAAGCTTGCCACCATGGTGTACCCCTACGACGTGCCCGACTACGCCGGATCCG CCGGATCCTTTTTGAATTG 22 TTTAAGCTTGCCACCATGGTGCAGAAGCTGATCTCAGAGGAGGACCTGGGATCCG...
  • 144
  • 48
  • 0

Teachers’ use of the mother tongue in English language classrooms for young learners at a language center A case study = Điển cứu về việc sử dụng tiếng mẹ đẻ củ

Teachers’ use of the mother tongue in English language classrooms for young learners at a language center A case study = Điển cứu về việc sử dụng tiếng mẹ đẻ củ
... read and understand foreign language literature, and translate each language into the other It is believed that everything in English should be taught by translating from the target language into ... into the MT and vice versa (Larsen- Freeman, 2000:74) Therefore, the language most used in the class is the students‟ native language Patel and Jain (2008) also state that, in GTM, because of the ... that non- native teachers could achieve all of the characteristics such as 11 fluency and appropriate use of language in the process of training He went further in arguing that non-native teachers...
  • 59
  • 97
  • 0

SUMMARY OF THESIS TEACHERS USE OF THE MOTHER TONGUE IN ENGLISH LANGUAGE CLASSROOMS FOR YOUNG LEARNERS AT A LANGUAGE CENTER A CASE STUDY

SUMMARY OF THESIS TEACHERS USE OF THE MOTHER TONGUE IN ENGLISH LANGUAGE CLASSROOMS FOR YOUNG LEARNERS AT A LANGUAGE CENTER A CASE STUDY
... beliefs and practices about the use of L1 In S Borg (Ed.) Investigating English language teaching and learning in Oman Muscat: Ministry of Education, Oman Al-Buraiki, M .A (2008) The L1 in Young Learner ... Languages and International Studies, Hanoi Drosatou, V (2009) The use of the mother tongue in English language classes for young learners in Greece Unpublished Master of Arts in ELT dissertation, ... attitudes toward the use of mother tongue in English language classrooms at Hon Gai high school Unpublished M .A thesis, Vietnam National University Hanoi, University of Languages and International Studies,...
  • 15
  • 240
  • 0

Xem thêm

Từ khóa: Xác định mức năng lượng trao đổi, protein thô, lysine và methionine trong khẩu phần của gà Sao (Numida meleagris) nuôi lấy thịt ở Đồng bằng sông Cửu Long (3)_unprotectedGiải bài toán về va chạm dọc của hai thanh đàn hồi và ứng dụng vào bài toán đóng cọcGiải ngân vốn hỗ trợ phát triển chính thức (ODA) ở Việt Nam - Thực trạng và giải phápGiải pháp xây dựng đội ngũ nữ cán bộ quản lý trường trung học cơ sở huyện Đông Triều tỉnh Quảng Ninh trong giai đoạn hiện nayHợp đồng thuê khai thác tàu bay trong lĩnh vực hàng không dân dụng tại Việt NamCác yêu cầu đối với quyết định của các cơ quan hành chính nhà nước Việt Nam trong giai đoạn hiện nayCải cách kinh tế ở Ấn Độ và bài học kinh nghiệm đối với Việt NamCăn cứ quyết định hình phạt những vấn đề lý luận và thực tiễnPhân tích mối quan hệ giữa vùng kinh tế trọng điểm phía Nam với các vùng kinh tế khác dựa trên mô hìSectoral composition of growth and poverty reduction in VietnamNGÔN NGỮ HỌC KHỐI LIỆU TRONG NỀN KINH TẾ TOÀN CẦUNgười đại diện theo pháp luật trong Luật doanh nghiệp 2005Những nguyên tắc của trọng tài thương mại theo pháp luật Việt NamNhững thách thức với các nhà nước phúc lợi châu Âu trong thế kỷ XXINHỮNG TRỤC CHÍNH TÂM CỦA ĐÔ THỊ THĂNG LONG HÀ NỘINonlinear Analysis on Flutter of Functional Graded Cylindrical Panels on Elastic Foundations Using tOn some controversially discussed Raman and IR bands of beryl Objective and Subjective Factors Influence on Demand of Drainage by Pumpingin Red River DeltaQuản lý kinh tế của cơ quan nhà nước đối với doanh nghiệp nhà nướcPhát hiện ảnh giả mạo dựa trên mẫu nhiễu cảm biếnViệc làm ở nông thôn Việt Nam hiện nay
Nạp tiền Tải lên
Đăng ký
Đăng nhập