21070 for during

For, during và while

For, during và while
... For, during while Chúng ta dùng during + danh từ để lúc việc xảy (không phải “trong bao lâu”): During the film during our holiday during the nigh (trong buổi chiếu ... during while thí dụ sau: - We met a lot of interesting people during our holiday 2/3 For, during while (Chúng gặp nhiều người thú vị kỳ nghỉ chúng tôi.) - We met a lot of interesting people while ... rained during the night (Mặt đất ẩm ướt Chắc hẳn đem trời mưa) - I’ll phone you sometime during the afternoon (Tôi gọi điện thoại cho bạn vào lúc buổi chiều nay) During while Chúng ta dùng during...
  • 3
  • 139
  • 0

21093 for during

21093 for  during
... to sleep DURING the film We played tennis FOR two hours I lived in London FOR a year I taught in Mexico FOR six years 10 I got a headache DURING the examination 11 We visited Kyoto DURING our ... FOR two hours DURING the afternoon 13 It has been snowing FOR half an hour 14 Alex and his wife met DURING the war 15 Could I talk to you FOR a few minutes? 16 Can I ask you a few questions DURING ... We didn’t speak DURING the meal I stayed in Rome FOR five days The students looked very bored DURING the lesson Yesterday I watched TV FOR three hours I don’t usually watch TV DURING the day I...
  • 2
  • 19
  • 0

Báo cáo y học: "Evaluation of maternal infusion therapy during pregnancy for fetal development"

Báo cáo y học:
... prevalence of infusion during the study pregnancy in any CA-groups On the other hand the maternal infusion during the study pregnancy showed 139 a lower occurrence in two CA-groups: hypospadias ... prevalence of maternal infusion in the group of total CAs, and within them, of hypospadias and multiple CAs Thus, we were not able to detect any teratogenic potential of infusion treatment during pregnancy ... dimenhydrinate usage during pregnancy Arch Obstet Gynecol 2005; 271: 113-118 Czeizel AE, Puhó E, Bánhidy F, Ács N Oral pyridoxine during pregnancy Potential protective effect for cardiovascular malformation...
  • 6
  • 180
  • 0

Tài liệu Investigation of Organic Chemicals Potentially Responsible for Mortality and Intersex in Fish of the North Fork of the Shenandoah River, Virginia, during Spring of 2007 ppt

Tài liệu Investigation of Organic Chemicals Potentially Responsible for Mortality and Intersex in Fish of the North Fork of the Shenandoah River, Virginia, during Spring of 2007 ppt
... E.T., and Holmes, J., 2008, Investigation of organic chemicals potentially responsible for mortality and intersex in fish of the North Fork of the Shenandoah River, Virginia, during spring of 2007: ... liter (pg/L) Investigation of Organic Chemicals Potentially Responsible for Mortality and Intersex in Fish of the North Fork of the Shenandoah River, Virginia, during Spring of 2007 By David ... showing location of the two sampling sites on the North Fork of the Shenandoah River, Virginia Investigation of Organic Chemicals Potentially Responsible for Mortality and Intersex in Fish of the...
  • 24
  • 481
  • 0

Tài liệu Báo cáo khoa học: A systems biology approach for the analysis of carbohydrate dynamics during acclimation to low temperature in Arabidopsis thaliana doc

Tài liệu Báo cáo khoa học: A systems biology approach for the analysis of carbohydrate dynamics during acclimation to low temperature in Arabidopsis thaliana doc
... identification and simulation A mathematical model was developed, representing central carbohydrate metabolism in leaves of A thaliana The model was based on the following system of ordinary differential ... in A thaliana A D B E C F Fig Maximum activities of enzymes in central carbohydrate metabolism during cold exposure (A C) Vmax values of three invertase isoforms: vInv, nInv and eInv (D) Vmax of ... (1999) Acclimation of Arabid¨ opsis leaves developing at low temperatures Increasing cytoplasmic volume accompanies increased activities of enzymes in the Calvin cycle and in the sucrose-biosynthesis...
  • 13
  • 273
  • 0

Tài liệu Báo cáo khoa học: Differential expression of duplicated LDH-A genes during temperature acclimation of weatherfish Misgurnus fossilis Functional consequences for the enzyme ppt

Tài liệu Báo cáo khoa học: Differential expression of duplicated LDH-A genes during temperature acclimation of weatherfish Misgurnus fossilis Functional consequences for the enzyme ppt
... observations of the effects of seasonal temperature acclimation on the properties of purified LDH-A from skeletal muscle of weatherfish Misgurnus fossilis acclimatized to either °C (‘cold’ enzyme) or ... Assemblage of the clones yield the full-length cDNA sequences of at least two distinct LDH-A isoforms, which differ substantially in the coding sequence and length of the 3¢-UTR Therefore, isoform-specific ... adjusted to new functional states [24] To obtain a better understanding of the mechanisms of temperature adaptation in enzymes we studied LDH-A mRNA from the skeletal muscle of weatherfish M fossilis...
  • 11
  • 260
  • 0

Tài liệu Báo cáo Y học: Phosphorylation of initiation factor-2a is required for activation of internal translation initiation during cell differentiation ppt

Tài liệu Báo cáo Y học: Phosphorylation of initiation factor-2a is required for activation of internal translation initiation during cell differentiation ppt
... differentiation, translation mediated by cellular IRES elements benefits from phosphorylation of eIF2a Supplementary mechanisms for inhibition of global protein synthesis, such as reduced availability of the ... is commonly regulated at the level of eIF2a phosphorylation [4,24], we wished to check the status of eIF2a phosphorylation in cells undergoing differentiation For this purpose, the cells were ... observed for the IRES-less transcript from pLL Reduction of global protein synthesis during differentiation is accompanied by eIF2a phosphorylation The terminal differentiation process is usually accompanied...
  • 10
  • 201
  • 0

Cardiac and Hemodynamic Changes during Carbon Dioxide Pneumoperitoneum for Laparoscopic Gynecologic Surgery in Rajavithi Hospital ppt

Cardiac and Hemodynamic Changes during Carbon Dioxide Pneumoperitoneum for Laparoscopic Gynecologic Surgery in Rajavithi Hospital ppt
... provided with lactated Ringer solution The subjects were supine for induction and emergence from anesthesia, remaining in a flexed lateral decubitus position during laparoscopic intervention None of ... every minutes) for the remaining laparoscopic part of the procedure (measurements obtained every minutes), and after evacuation of the carbon dioxide A p-value of less than 0.05 was accepted for ... Cardiorespiratory data before, during and after CO2 insufflation in an extraperitoneal laparoscopy cohort Mean (SD) / p-value Parameter Before insufflation (base line) First 10 mins insufflation (every...
  • 5
  • 132
  • 0

Báo cáo khoa học: Saccharomyces cerevisiae Ybr004c and its human homologue are required for addition of the second mannose during glycosylphosphatidylinositol precursor assembly ppt

Báo cáo khoa học: Saccharomyces cerevisiae Ybr004c and its human homologue are required for addition of the second mannose during glycosylphosphatidylinositol precursor assembly ppt
... in Man2 addition to GPIs We conclude that human Ybr004cp is the functional equivalent of S cerevisiae Ybr004cp Discussion The majority of the steps in assembly and decoration of the GPI precursor ... protein (Ybr004cp) required for addition of the second mannose to GPI precursors Yeast cells depleted of Ybr004cp exhibit cell wall and morphological abnormalities, are defective in the incorporation ... with 1163 Second mannose addition to GPI precursors A A.-L Fabre et al B Fig ybr004c acts downstream of gpi1 and upstream of smp3 in the GPI biosynthetic pathway (A) A gpi1D ⁄ ybr004cDpGAL-YBR004c...
  • 9
  • 157
  • 0

NUTRIENT ADEQUACY OF EXCLUSIVE BREASTFEEDING FOR THE TERM INFANT DURING THE FIRST SIX MONTHS OF LIFE potx

NUTRIENT ADEQUACY OF EXCLUSIVE BREASTFEEDING FOR THE TERM INFANT DURING THE FIRST SIX MONTHS OF LIFE potx
... the uniform recommendation of exclusive breastfeeding for the first months of life is the lack of understanding of reasons for the marked attrition rates in exclusive breastfeeding, even among ... intentions to exclusively breastfeed for months, 23% of mothers added solids to their infant s diet at 4.5 months; 55% HUMAN-MILK INTAKE DURING EXCLUSIVE BREASTFEEDING IN THE FIRST YEAR OF LIFE Table ... determinants of the duration of exclusive breastfeeding A limitation to promoting exclusive breastfeeding for the first months of life is our lack of understanding of the reasons for the attrition rates...
  • 57
  • 204
  • 0

Báo cáo khoa học: A mammalian monothiol glutaredoxin, Grx3, is critical for cell cycle progression during embryogenesis doc

Báo cáo khoa học: A mammalian monothiol glutaredoxin, Grx3, is critical for cell cycle progression during embryogenesis doc
... 5¢-GGCTCTAGAATGTGTTCTTTTCAG GTTCCAT-3¢ and the reverse primer 5¢-CCGGAGCTCTT AAGATTGGAGAGCATGCTG-3¢ For ScGrx4, the we used the forward primer 5¢-GCCGGATCCATGACTGTG GTTGAAATAAAAAG-3¢ and the reverse primer 5¢-CCGG AGCTCTTACTGTAGAGCATGTTGGAAATA-3¢ ... specifically targeting human Grx3 sequences were purchased from SigmaAldrich The human Grx3 shRNA1 sequence is 5¢-CCG GGCTCTTTATGAAAGGAAACAACTCGAGTTGTTTC CTTTCATAAAGAGCTTTTTG-3¢ The human Grx3 shRNA2 ... 5¢-CATGGTGCCCAGAAATGAAC-3¢; probe (Grx3-79T): 5¢-CTACTGCGCCTCAAAACCAAGTCACT CCT-3¢ The housekeeping gene cyclophilin was used to normalize the gene expression data Mammalian monothiol glutaredoxin...
  • 15
  • 120
  • 0

Báo cáo khoa học: Directed evolution of formate dehydrogenase from Candida boidinii for improved stability during entrapment in polyacrylamide ppt

Báo cáo khoa học: Directed evolution of formate dehydrogenase from Candida boidinii for improved stability during entrapment in polyacrylamide ppt
... were introduced during the first step of evolution Stability of mutant FDHs in PAA Finally, the performance of the FDH variants after entrapment in PAA was investigated by measuring the activity in ... temperature of 30 °C for 30 The reaction was started by injecting 100 lmol of formate into the vial and stopped after 60 by injecting mL of HCl (1 molÆL)1) After another 30 of incubation, a gas sample of ... employing gel formation itself was therefore developed Effects of PAA building blocks on wild-type FDH Formation of PAA gels involves the cross-linking of acrylamide and bis-acrylamide monomers in...
  • 8
  • 161
  • 0

Xem thêm

Từ khóa: nghiên cứu mô hình liên kết khu vực, hội nhập của Liên minh châu Âu có thể góp phần định hướng cho sự phát triển của ASEAN trong tương lai, đặc biệt là quá trình hình thành Cộng đồng chung ASEANTOEIC exploration 1000 LC+RCHướng dẫn giải bài 1,2,3,4 trang 132 SGK toán 3200 câu tiếng anh viết lại câu ôn thi công chứcChủ Đề : Thế giới Thực vật tho hoa ket traiPHƯƠNG PHÁP DẠY HỌC CHƯƠNG TRÌNH HÓA ĐỂ DẠY CHƯƠNG TRÌNH HÓA HỌC LỚP 12 THEO CẤU TRÚC ĐƯỜNG THẲNGBồi dưỡng HSG Cơ chế phản ứng hữu cơBộ câu hỏi và đáp án môn kiến thức chung dành cho viên chức mới nhất năm 2017Thực trạng khai thác du lịch biển đảo trên địa bàn tỉnh quảng namThiết kế mô hình hệ thống cửa tự động đóng mở sử dụng sensor cảm biếnPhân tích thực trạng và kiến nghị một số giải pháp nhằm nâng cao hiệu quả kinh doanh lưu trú ở khách sạn bình minhCấu trúc viết lại câu tiếng anh ( HAY)Phát triển sản phẩm du lịch kết hợp team building của công ty TNHH thương mại du lịch văn hóaQuy hoạch chi tiết xây dựng thị trấn phát diệm huyện kim sơn tỉnh ninh bình giai đoạn 2010 2020Sử dụng thực vật lớn làm chỉ thị sinh học chất lượng nước hệ thống kênh mương thuỷ lợi trên địa bàn huyện gia lâm, hà nộiNhân vật chèo từ truyền thống đến hiện đại dưới góc nhìn văn hóaPhân loại và phương pháp giải bài toán hỗn hợp sắt và các hợp chất của sắtPhân tích hiệu quả hoạt động kinh doanh tại công ty TNHH xây dựng thương mại vận tải phan thànhPhát triển đội ngũ công chức trong các tổ chức chính trị xã hội huyện tây hòa, tỉnh phú yên dựa vào cộng đồngBáo cáo thực tập tốt nghiệp ngành công nghệ kĩ thuật nhiệt lạnh điều hòa không khí
Nạp tiền Tải lên
Đăng ký
Đăng nhập