37489 kateb yacine follow up

Báo cáo y học: "Sustained High Quality of Life in a 5-Year Long Term Follow-up after Successful Ablation for Supra-Ventricular Tachycardia. Results from a large Retrospective Patient Cohort"

 Báo cáo y học:
... EAT patients Panel A: Quantity and duration of episodes and the associated symptoms Panel B: Detraction in daily life generally and in parts of daily life variable PANAL A Detraction in daily life ... (Years) All patients AVNRT AVRT EAT From symptom to ablation (Years) All patients AVNRT AVRT EAT RF-Applications (Number) All patients AVNRT AVRT EAT Examination time (Minutes) All patients AVNRT AVRT ... (6) Y- axis: Percentage of patients Panel A: AVNRT Panel B: AVRT Panel C: EAT Comparing the categorical variables before and after ablation in AVNRT patients, applying the McNemar-Test we found a...
  • 9
  • 213
  • 0

The Follow-Up Letter

The Follow-Up Letter
... Few of the people with whom you’ll meet are trained recruiters or skilled interviewers They are simply managers with a position to fill A strong follow-up letter can help them accomplish the following: ... ocr cu LETTER 6-3: FOLLOW-UP LETTER ATTORNEY When her interview was interrupted, this writer continued it by telephone She used this unique fact to remind the reader of their meeting and then continued ... happen Sincerely, Voilet Nance Murray 198 LETTER 6-8: FOLLOW-UP LETTER GENERAL The Case of the Poor Interviewer: Although this candidate could tell that the employer was impressed with her qualifications,...
  • 21
  • 73
  • 0

Tài liệu Follow-Up of the patient who has received pacemaker pptx

Tài liệu Follow-Up of the patient who has received pacemaker pptx
... analyze the data and has the capability of sending them on to the physician's office Data are being gathered on the utility of these more sophisticated devices One of the goals is to reduce the need ... reprogramming the pacemaker, surgically exploring and changing the lead position, or replacing the lead or the pacemaker generator or both The clinical status of the patient is of key importance in the ... patients Any patient who has a device should be part of a follow-up clinic for appropriate management of the device and also, if a defect does arise, allow assessment of the situation Often the...
  • 26
  • 102
  • 0

Marketing Violent Entertainment to Children: A Fifth Follow-up Review of Industry Practices in the Motion Picture, Music Recording & Electronic Game Industries pdf

Marketing Violent Entertainment to Children: A Fifth Follow-up Review of Industry Practices in the Motion Picture, Music Recording & Electronic Game Industries pdf
... days after release of the game, a game company is required to submit game packaging and a final version of the game to the ESRB The ESRB checks the game packaging to see if the rating information ... buying these products The music recording industry maintains that the Parental Advisory is not meant to indicate that a sound recording is either appropriate or inappropriate for any particular ... packaging, the movie industry typically places the movie’s rating and rating reasons on the back of each video and DVD Although the electronic game industry places the rating on the front of the...
  • 138
  • 112
  • 0

The natural history of non-alcoholic fatty liver disease in children: a follow-up study for up to 20 years pptx

The natural history of non-alcoholic fatty liver disease in children: a follow-up study for up to 20 years pptx
... Laboratory evaluation included liver biochemistries (serum aspartate aminotransferase (AST), alanine aminotransferase (ALT), alkaline phosphatase activity, c-glutamyl transferase (GGT), total bilirubin, ... method The starting point for survival analysis was date of diagnosis of NAFLD Patient follow -up was extended up to April 200 8 The end-points for survival analysis were death or liver transplantation ... were also common The main laboratory data gathered at the time of NAFLD diagnosis are summarised in table ALT and AST levels were each within the normal range in few patients 1539 Hepatology Table...
  • 7
  • 176
  • 0

Conservative and Aesthetic Emergency Management in Adolescent with Complex Crown-Root Fracture and Simultaneous Oblique Root Fracture in Upper Maxillary Central Incisor: Clinical Outcome after 18 Months Follow-up Period docx

Conservative and Aesthetic Emergency Management in Adolescent with Complex Crown-Root Fracture and Simultaneous Oblique Root Fracture in Upper Maxillary Central Incisor: Clinical Outcome after 18 Months Follow-up Period docx
... and aesthetic emergency management in adolescent with complex crown -root fracture and simultaneous oblique root fracture in upper maxillary central incisor: clinical outcome after 18 months follow-up ... A Conservative and aesthetic emergency management in adolescent with complex crown -root fracture and simultaneous oblique root fracture in upper maxillary central incisor: clinical outcome after ... A Conservative and aesthetic emergency management in adolescent with complex crown -root fracture and simultaneous oblique root fracture in upper maxillary central incisor: clinical outcome after...
  • 11
  • 112
  • 0

Global Strategy for Women''''s and Children''''s Health : Accountability Commission follow up Recommendation 10 Global Oversight pptx

Global Strategy for Women''''s and Children''''s Health : Accountability Commission follow up Recommendation 10 Global Oversight pptx
... 2011 10 Global Strategy for Women’s and Children’s Health Global Oversight Accountability Framework: 10 Recommendations Name 11 Global Strategy for Women’s and Children’s Health Global Oversight ... CHRONOLOGY: • The UN Global Strategy for Women's and Children's Health September 2 010 Commission on Information and Accountability for Women’s and Children’s Health and Accountability Framework of 10 ... Commission on Information and Accountability for Women’s and Children’s Health Name Global Strategy for Women’s and Children’s Health Global Oversight Commissioners 1st Meeting of the Commissioners,...
  • 37
  • 104
  • 0

báo cáo hóa học: " Improvement of quality of life, anxiety and depression after surgery in patients with stress urinary incontinence: Results of a longitudinal short-term follow-up" docx

báo cáo hóa học:
... impact of urinary incontinence on self-efficacy and quality of life Health and Quality of Life Outcomes 2003, 1:35 Parkkinen A, Karjalainen E, Vartiainen M, Penttinen J: Physiotherapy for Female ... Baseline weeks Assessment Figure Changes 2in anxiety and depression (HADS) Changes in anxiety and depression (HADS) Avoidance, Psychosocial-Impact, Social Embarrassment and Total-Score (see Table ... (Cronbach's alpha 0.95) and high retest-reliability (0.91) Each subscale also showed acceptable alpha values (0.87–0.93) [33] Hospital Anxiety and Depression Scale (HADS) The Hospital Anxiety and Depression...
  • 11
  • 184
  • 0

báo cáo hóa học: " Onset and persistence of person-perceived participation restriction in older adults: a 3-year follow-up study in the general population" pptx

báo cáo hóa học:
... restricted in an aspect of life if they did not participate in it "as and when they wanted" for "all" or "most of the time" The number of aspects of life, where responders indicated participation restriction, ... lost at follow-up had the same likelihood of participation restriction (examining onset and persistence separately), within strata defined by age, gender, educational attainment, occupational class ... stratified by age group and gender In individuals with participation restriction at baseline, estimates of persistence within each of the 11 aspects of life were calculated overall, and by age and...
  • 11
  • 174
  • 0

báo cáo hóa học: " Changes in quality of life among Norwegian school children: a six-month follow-up study" doc

báo cáo hóa học:
... when assessing changes in QoL in clinical populations Abbreviations ANOVA: Analysis of variance; ANCOVA: Analysis of covariance; EM: Expectation maximization; ES: Effect size; ICC: Intraclass ... Physical well-being scale was not included in the analysis, but was used in calculating KINDL QoL total score for all grades Assessment procedures One teacher at each school was appointed as a project ... Reinfjell T, Diseth TH, Veenstra M, Vikan A: Measuring healthrelated quality of life in young adolescents: Reliability and validity in the Norwegian version of the Pediatric Quality of Life Inventory...
  • 12
  • 160
  • 0

báo cáo hóa học: " Co-morbidity and visual acuity are risk factors for health-related quality of life decline: five-month follow-up EQ-5D data of visually impaired older patients" ppt

báo cáo hóa học:
... general analyses on the EQ-5D To put the EQ-5D scores from the visually impaired older population into perspective, we compared baseline data of the visually impaired older patients (mean age ... more of the visually impaired older patients reported having some or severe problems on all dimensions of the EQ-5D compared with both reference groups However, the proportion of visually impaired ... multimorbidity and healthrelated quality of life of patients in primary care Qual Life Res 2006, 15:83-91 Fortin M, Lapointe L, Hudon C, Vanasse A, Ntetu AL, Maltais D: Multimorbidity and quality of life...
  • 9
  • 159
  • 0

Báo cáo sinh học: " HBx M130K and V131I (T-A) mutations in HBV genotype F during a follow-up study in chronic carriers" potx

Báo cáo sinh học:
... CAGGTTAAA TATTAGGAGGCTGTAGGCA 6541m_27-0 CAGGTtAAA TATTAGGAGGCTGTAGGCA 6290m_1232 CAGGTTAAA TATTAGGAGGCTGTAGGCA 467h_969-0 CAGGttAAA TATTAGGAGGCTGTAGGCA Consensus CAGGTTAAATATTAGGAGGCTGTAGGCA ... The hepatitis B virus (HBV) is a small double stranded DNA virus that produces a chronic infection in 2–10% of adults and in approximately 90% of infected infants Approximately 10% of these chronic ... Investigaciones Científicas y Tecnológicas (National Council for Science Research and Technology) and Organización Panamericana de la Salud (Health Panamerican Organization) grant The authors thank all...
  • 10
  • 144
  • 0

báo cáo hóa học: " Low ficolin-3 levels in early follow-up serum samples are associated with the severity and unfavorable outcome of acute ischemic stroke" pptx

báo cáo hóa học:
... Ficolin-3 and CRP levels in follow-up samples correlate with the outcome of acute ischemic stroke The levels of the ficolins and CRP were related to the outcome of the disease, as assessed by the modified ... distribution, and reproduction in any medium, provided the original work is properly cited 1 Low ficolin-3 levels in early follow-up serum samples are associated with the severity and unfavorable outcome ... assess the strength of association between the low ficolin-3 and high CRP levels on the one hand and the unfavorable outcome of the disease on the other hand, we repeated the analysis as above in the...
  • 27
  • 149
  • 0

Xem thêm

Nạp tiền Tải lên
Đăng ký
Đăng nhập