... nhân viêm < /b> gan < /b> B mãn Xuất phát < /b> từ nhu cầu thực tiễn, chọn đề tài Xây < /b> dựng < /b> quy < /b> trình < /b> phát < /b> đột < /b> biến < /b> rtA181V/T < /b> rtN236T < /b> kháng < /b> Adefovir < /b> virus < /b> viêm < /b> gan < /b> B (Hepatitis B Virus) kỹ thuật realtime PCR , ... phát < /b> nhanh đột < /b> biến < /b> kháng < /b> thuốc, với giá thành thấp có ý nghĩa công tác theo dõi điều trị b nh viêm < /b> gan < /b> siêu vi B Mục đích đề tài: Xây < /b> dựng < /b> quy < /b> trình < /b> xác định đột < /b> biến < /b> kháng < /b> thuốc Adefovir < /b> HBV ... nhiều nghiên cứu b nh viện sở y tế ứng dụng phương pháp giải trình < /b> tự PCR để phát < /b> đột < /b> biến < /b> kháng < /b> thuốc HBV b nh nhân viêm < /b> gan < /b> B mãn điều trị, có đột < /b> biến < /b> kháng < /b> ADV vị trí rtA181T/V rtN236T < /b> Tuy nhiên,...
  • 99
  • 463
  • 3

Xây dựng quy trình phát hiện đột biến rta181v t rtn236t kháng adefovir của virus viêm gan b (hepatitis b virus) bằng kỹ thuật real time PCR

Xây dựng quy trình phát hiện đột biến rta181v t và rtn236t kháng adefovir của virus viêm gan b (hepatitis b virus) bằng kỹ thuật real time PCR
... huy t < /b> b nh nhân viêm < /b> gan < /b> B mãn Xu t < /b> ph t < /b> < /b> t< /b> nhu cầu thực tiễn, chọn đề t< /b> i Xây < /b> dựng < /b> quy < /b> trình < /b> ph t < /b> < /b> đ t < /b> < /b> biến < /b> rtA181V/< /b> T < /b> rtN23 6T < /b> kháng < /b> Adefovir < /b> virus < /b> viêm < /b> gan < /b> B (Hepatitis B Virus) kỹ thu t < /b> realtime ... Adefovir < /b> rtA18 1T/< /b> V rtN23 6T < /b> đơn giản, xác, giá thành thấp cần thi t < /b> Để đáp ứng nhu cầu đó, xây < /b> dựng < /b> kỹ thu t < /b> real- time PCR nhằm ph t < /b> < /b> đ t < /b> < /b> biến < /b> kháng < /b> Adefovir < /b> công trình < /b> chưa công b trước Vi t < /b> Nam B ... kháng < /b> thuốc Adefovir < /b> HBV rtA181V/< /b> T < /b> rtN23 6T < /b> kỹ thu t < /b> real- time PCR sử dụng TaqMan probe, chi phí thấp để ph t < /b> < /b> triển thành kit phục vụ trình < /b> điều trị viêm < /b> gan < /b> siêu vi B t< /b> ơng lai Đối t< /b> ợng nghiên...
  • 20
  • 87
  • 0


... nhân viêm < /b> gan < /b> B mãn Xuất phát < /b> từ nhu cầu thực tiễn, chọn đề tài Xây < /b> dựng < /b> quy < /b> trình < /b> phát < /b> đột < /b> biến < /b> rtA181V/T < /b> rtN236T < /b> kháng < /b> Adefovir < /b> virus < /b> viêm < /b> gan < /b> B (Hepatitis B Virus) kỹ thuật realtime PCR , ... phát < /b> nhanh đột < /b> biến < /b> kháng < /b> thuốc, với giá thành thấp có ý nghĩa công tác theo dõi điều trị b nh viêm < /b> gan < /b> siêu vi B Mục đích đề tài: Xây < /b> dựng < /b> quy < /b> trình < /b> xác định đột < /b> biến < /b> kháng < /b> thuốc Adefovir < /b> HBV ... nhiều nghiên cứu b nh viện sở y tế ứng dụng phương pháp giải trình < /b> tự PCR để phát < /b> đột < /b> biến < /b> kháng < /b> thuốc HBV b nh nhân viêm < /b> gan < /b> B mãn điều trị, có đột < /b> biến < /b> kháng < /b> ADV vị trí rtA181T/V rtN236T < /b> Tuy nhiên,...
  • 99
  • 101
  • 0

nghiên cứu xây dựng quy trình phát hiện một số đột biến gen gây bệnh β-thalassemia

nghiên cứu và xây dựng quy trình phát hiện một số đột biến gen gây bệnh β-thalassemia
... chẩn đoán đột biến gen β-thalassemia nghiên cứu chưa sử dụng rộng rãi chẩn đoán trước sinh Từ vấn đề nêu cần tiến hành đề tài Nghiên cứu xây dựng quy trình phát số đột biến gen gây bệnh βthalassemia” ... BỘ GIÁO DỤC VÀ ĐÀO TẠO BỘ Y TẾ TRƯỜNG ĐẠI HỌC Y HÀ NỘI …… ***…… LÊ THẾ KHƯƠNG NGHIÊN CỨU VÀ XÂY DỰNG QUY TRÌNH PHÁT HIỆN MỘT SỐ ĐỘT BIẾN GEN GÂY BỆNH β-THALASSEMIA KHÓA LUẬN TỐT ... tử giúp cho chẩn đoán đột biến gen gây bệnh dễ dàng xác giúp cho hạn chế trẻ sơ sinh mang gen đột biến Ở nước ta kỹ thuật giúp cho chẩn đoán đột biến gen nghiên cứu đạt số thành tựu định Tuy...
  • 61
  • 290
  • 2

Bước đầu xây dựng quy trình phát hiện đồng thời các tác nhân vi khuẩn từ các mẫu bệnh phẩm gây bệnh cho con người bằng phương pháp PCR kết hợp Reverse Dot Lot

Bước đầu xây dựng quy trình phát hiện đồng thời các tác nhân vi khuẩn từ các mẫu bệnh phẩm gây bệnh cho con người bằng phương pháp PCR kết hợp Reverse Dot Lot
... u qu vi c phát hi xác tác nhân vi khu n gây b nh nhi u tr khóa lu n t t nghi ng th i tr n cho b nh nhân, th c hi u xây d ng quy trình phát hi tài ng th i tác nhân vi khu n t m u b nh ph m gây ... gen 16S phát hi n nhanh tác nhân vi khu n gây b nh d a Real time PCR, Multiplex PCR, PCR gi i trình t , 33 B ng III.2 Các k thu t sinh h c phân t s d nh nhanh vi khu n gây b nh S công trình K ... nhi u tác nhân vi khu n gây b nh (nhóm vi khu n gây b ng ru t) m t s ngu n m u b nh ph m thu th c t i Vi t Nam 24 II.1 Trong nghiên c u s d ng 15 m u máu (chai c c m tác nhân vi sinh v t gây nhi...
  • 98
  • 121
  • 1

xây dựng quy trình phát hiện virus PMWaV-1

xây dựng quy trình phát hiện virus PMWaV-1
... 70 PMWaV-1 Áp dụng quy trình vừa xây dựng, giám định PMWaV-1 90 chồi dứa Cayenne thuộc giống: Thái Lan, Trung Quốc Lâm Đồng Các kết thu được: Ly trích RNA tổng số từ mẫu dứa Xây dựng quy trình ... hoạch, phát bệnh, gây thiệt hại lớn cho người trồng Chính vậy, tiến hành thực đề tài "Xây dựng qui trình phát virus PMWaV-1 gây bệnh đỏ đầu chồi dứa Cayenne phương pháp RT-PCR" nhằm xây dựng phương ... cần thiết để đánh giá xác diện PMWaV-1 Như vậy, kết luận quy trình RT-PCR xây dựng hoàn toàn đủ độ tin cậy việc phát PMWaV-1 Hình 4.5: Sơ đồ phản ứng RT-PCR phát PMWaV-1 51 4.3 Kết kiểm tra sản...
  • 66
  • 216
  • 1

Nghiên cứu một số virus (TMV, CMV) gây bệnh trên cây Ớt tại huyện Củ Chi, TP. Hồ Chí Minh bằng kỹ thuật ELISA xây dựng quy trình phát hiện CMV bằng kỹ thuật RT-PCR

Nghiên cứu một số virus (TMV, CMV) gây bệnh trên cây Ớt tại huyện Củ Chi, TP. Hồ Chí Minh bằng kỹ thuật ELISA và xây dựng quy trình phát hiện CMV bằng kỹ thuật RT-PCR
... dân huyện Chính lí mà đề tài Nghiên cứu virus (TMV, CMV) gây bệnh ớt huyện Củ Chi, Tp Hồ Chí Minh kỹ thuật ELISA xây dựng quy trình phát CMV kỹ thuật RT-PCR đƣợc thực nhằm xác định sớm mầm bệnh, ... DỤC VÀ ĐÀO TẠO ĐẠI HỌC NÔNG LÂM TP HỒ CHÍ MINH BỘ MÔN CÔNG NGHỆ SINH HỌC ….  … NGHIÊN CỨU VIRUS (TMV, CMV) GÂY BỆNH TRÊN CÂY ỚT TẠI HUYỆN CỦ CHI, TP HỒ CHÍ MINH BẰNG KỸ THUẬT ELISA VÀ XÂY DỰNG ... bệnh hoa Lili kỹ thuật RT-PCR Qua cho thấy kỹ thuật RT-PCR có độ nhạy cao so với kỹ thuật ELISA việc phát virus gây bệnh 2.5.2 Ở Việt Nam Các nghiên cứu bệnh virus mới, có số nghiên cứu trƣờng Đại...
  • 69
  • 437
  • 2

Xây dựng Quy trình phát hiện Escherichia Coli trong thực phẩm bằng phương pháp PCR(Polumerase Chain Reaction) thử nghiệm ứng dụng

Xây dựng Quy trình phát hiện Escherichia Coli trong thực phẩm bằng phương pháp PCR(Polumerase Chain Reaction) và thử nghiệm ứng dụng
... phản ứng PCR cho phép phát 2.7 Quy trình mật E 103 CFU/ml hay 3CFU/ ng phươngPCR PCR E coli phát độ x coli thực phẩm bằ phản ứng pháp Căn vào kết thí nghiệm trên, đề nghò qui trình PCR để phát ... TSB Gây nhiễm E coli mật độ Ủ 370C 24 Phát E coli Phát E coli phương pháp truyền thống phươngpháp PCR Hình Sơ đồ khảo sát giới hạn phát E coli mẫu thực phẩm gây nhiễm theo phương pháp truyền thống ... lây nhiễm dẫn đến biến chứng CÁC PHƯƠNG PHÁP PHÁT HIỆN E COLI TRONG THỰC PHẨM 3.1 Phương pháp nuôi cấy truyền thống [6,10] Phương pháp nuôi cấy truyền thống để phát E coli gồm ba bước: (1) tăng...
  • 67
  • 727
  • 6

Nghiên cứu xây dựng quy trình phát hiện nhanh virus cúm gia cầm a h5n1 trong mẫu bệnh phẩm bằng kỹ thuật multiplex reverse transcription polymerase chain reaction

Nghiên cứu xây dựng quy trình phát hiện nhanh virus cúm gia cầm a h5n1 trong mẫu bệnh phẩm bằng kỹ thuật multiplex reverse transcription polymerase chain reaction
... GTGACAGGATTGGTCTTGTCTT 158-139 55.8 DiagH5F AGTGATCAGATTTGCATTGGTTAC 46-69 54.6 DiagH5R GACCAAGAACTTTTGGGGATG 416-396 55.4 DiagN1F CCAGTTGGTTGACAATTGGAAT 503-524 54.5 DiagN1R GCATCAGGATAACAGGAGCA ... Influenza, 12th edn Ames, IA: Blackwell Publishing Professional 46 Takano R, Nidom CA, Kiso M, Muramoto Y, Yamada S, Sakai-Tagawa Y, Macken C, Kawaoka Y (2009), “Phylogenetic characterization of H5N1 ... H5 and H7 avian influenza viruses: amino acid sequence at the HA cleavage site as a marker of pathogenicity potential”, Avian Diseases, 40: 425437 45 Swayne DE and Halverson DA (2007), Diseases...
  • 11
  • 196
  • 0


... dân huyện Chính lí mà đề tài Nghiên cứu virus (TMV, CMV) gây bệnh ớt huyện Củ Chi, Tp Hồ Chí Minh kỹ thuật ELISA xây dựng quy trình phát CMV kỹ thuật RT-PCR đƣợc thực nhằm xác định sớm mầm bệnh, ... DỤC VÀ ĐÀO TẠO ĐẠI HỌC NÔNG LÂM TP HỒ CHÍ MINH BỘ MÔN CÔNG NGHỆ SINH HỌC ….  … NGHIÊN CỨU VIRUS (TMV, CMV) GÂY BỆNH TRÊN CÂY ỚT TẠI HUYỆN CỦ CHI, TP HỒ CHÍ MINH BẰNG KỸ THUẬT ELISA VÀ XÂY DỰNG ... bệnh hoa Lili kỹ thuật RT-PCR Qua cho thấy kỹ thuật RT-PCR có độ nhạy cao so với kỹ thuật ELISA việc phát virus gây bệnh 2.5.2 Ở Việt Nam Các nghiên cứu bệnh virus mới, có số nghiên cứu trƣờng Đại...
  • 69
  • 261
  • 0

xây dựng quy trình phát hiện thịt trong thực phẩm chay bằng phương pháp pcr gen 16s ty thể

xây dựng quy trình phát hiện thịt trong thực phẩm chay bằng phương pháp pcr gen 16s ty thể
... TẠO TRƯỜNG ĐẠI HỌC NHA TRANG NGUYỄN THỊ MỸ DIỄM XÂY DỰNG QUY TRÌNH PHÁT HIỆN THỊT TRONG THỰC PHẨM CHAY BẰNG PHƯƠNG PHÁP PCR GEN 16S TY THỂ ĐỒ ÁN TỐT NGHIỆP ĐẠI HỌC CHUYÊN NGÀNH CÔNG NGHỆ ... thực phản ứng PCR 4) Thử nghiệm phát thịt thực phẩm chay phản ứng PCR gen 16S ty thể Về phương diện khoa học, quy trình nhận biết có mặt DNA loài động vật nói chung Về mặt thực tiễn, phương pháp ... dựng quy trình phát thịt thực phẩm chay phương pháp PCR gen 16S ty thể Mục đích đồ án: đánh giá xác nhận biết nhanh chóng có mặt thịt sản phẩm chay Nội dung: 1) Thiết kế mồi cho phản ứng PCR 2)...
  • 58
  • 325
  • 4

Đề Tài: Bước đầu xây dựng quy trình phát hiện ASPERGILLUS FLAVUS sinh độc tố AFLATOXIN trên ngũ cốc bằng phương pháp phát quang potx

Đề Tài: Bước đầu xây dựng quy trình phát hiện ASPERGILLUS FLAVUS sinh độc tố AFLATOXIN trên ngũ cốc bằng phương pháp phát quang potx
... điểm phát huỳnh quang Khảo sát yếu tố ảnh hưởng đến phát huỳnh quang chủng A flavus sinh Aflatoxin Xây dựng dự thảo phương pháp Phát Aspergillus flavus sinh độc tố Aflatoxin ngũ cốc phương pháp ... MỞ ĐẦU * Mục tiêu đề tài: Xây dựng quy trình phát nấm mốc Aspergillus flavus có khả sinh độc tố Aflatoxin nhằm kiểm soát chất lượng ngũ cốc cung cấp dẫn liệu khoa học tồn khả có sinh độc tố Aflatoxin ... nhiên cán hướng dẫn khoa học, tiến hành đề tài nghiên cứu: Bước đầu xây dựng phương pháp phát Aspergillus flavus sinh độc tố Aflatoxin ngũ cốc phương pháp phát quang HVTH: VÕ THỊ THANH TRANG LUẬN...
  • 109
  • 542
  • 1


... chất lượng mỹ phẩm theo Thông tư 06/2011/TT-BYT 1.2 MỘT SỐ HỢP CHẤT CẤM SỬ DỤNG VÀ CẦN KIỂM SOÁT HÀM LƯỢNG NGHIÊN CỨU TRONG ĐỀ TÀI 1.2.1 Một số hợp chất màu bị cấm sử dụng mỹ phẩm 1.2.2 Một số ... BỘ GIÁO DỤC VÀ ĐÀO TẠO BỘ Y TẾ TRƯỜNG ĐẠI HỌC DƯỢC HÀ NỘI LÊ THỊ HƯỜNG HOA NGHIÊN CỨU XÂY DỰNG QUY TRÌNH PHÁT HIỆN VÀ XÁC ĐỊNH HÀM LƯỢNG MỘT SỐ CHẤT BỊ CẤM SỬ DỤNG TRONG MỸ PHẨM CHUYÊN NGÀNH: ... thành phần cần ý 1.2 MỘT SỐ HỢP CHẤT BỊ CẤM SỬ DỤNG VÀ CẦN KIỂM SOÁT HÀM LƯỢNG NGHIÊN CỨU TRONG ĐỀ TÀI 1.2.1 Một số hợp chất màu bị cấm sử dụng mỹ phẩm Các hợp chất màu chất có màu trạng thái...
  • 218
  • 502
  • 1


  • 6
  • 134
  • 0

Xem thêm

Từ khóa: xây dựng quy trình thực hiện công việcxây dựng chương trình phát hiện tấn công dos sử dụng kỹ thuật khai phá dữ liệucác nguyên tắc và yêu cầu xây dựng quy trình thực hiện dạy học thực hành kỹ thuật theo tiếp cận tương tácxây dựng quy trình phát triển văn hóa doanh nghiệptrình phát hiện đột biến kháng isoniazid rifampin và ethambutol của mtbcơ sở khoa học của việc xây dựng quy trình sản xuất chế biến món ănxây dựng quy trình sản xuất chế biến món ănnghiên cứu xây dựng quy trình chế biến hắc phụ bạch phụ và bào chế cao phụ tử ở quy mô pilotxây dựng quy trinh bán hàng tại công ty vinacafe bien hoanghiên cứu xây dựng quy trình quản lý đầu tư ứng dụng công nghệ thông tin tại ngân hàng phát triển việt namxây dựng quy trình mối nguy đánh giá rủi ro và xác định biện pháp kiểm soátnghien cuu xay dung quy trinh hoan tho phuc hoi moi truong o cac vung khai thac va che bien khoang sanbiện pháp 5 xây dựng quy trình sử dụng giáo án dạy học tích cực có ứng dụng công nghệ thông tinbiện pháp 2 xây dựng quy trình đào tạo đặc thù cho phương thức liên kết và quản lý chặt chẽ quá trình dạy họcxây dựng quy trình thành lập bản đồ biến động lớp phủ mặt đất1 de thi minh hoa thptqg mon vat ly cua bo giao duc co loi giai4 thpt tran hung dao tphcm nam 2017 lan 2 co loi giai5 thpt nong cong 2 thanh hoa nam 2017 lan 1 co loi giai6 thpt thuan thanh bac ninh nam 2017 lan 1 co loi giai8 thpt ha trung thanh hoa nam 2017 lan 1 co loi giaiCực trị hàm số Trắc nghiệm Toán 2017 Thầy Trần Tài13 so gddt vinh phuc nam 2017 lan 1 co loi giaithpt chuyen vinh phuc vinh phuc nam 2017 lan 1 co loi giai16 thpt luong tai so 2 bac ninh nam 2017 lan 1 co loi giaiThế Lực Khách Trú Và Vấn Đề Di Dân Vào Nam KỳSlide bài giảng Tư tưởng Hồ Chí Minh Chương 3Strategic management planing for domestic and global competition 14th john robinson chapter 4Strategic management planing for domestic and global competition 14th john robinson chapter 13Strategic management planing for domestic and global competition 14th john robinson chapter 6Strategic management planing for domestic and global competition 14th john robinson chapter 7Strategic management planing for domestic and global competition 14th john robinson chapter 8Strategic management planing for domestic and global competition 14th john robinson chapter 10Strategic management planing for domestic and global cometition 14th john robinson chapter 11CƠ SỞ VĂN HÓA VIỆT NAMPhát triển kinh tế hộ nông dân gắn với giảm nghèo bền vững ở tỉnh bắc kạn
Đăng ký
Đăng nhập