68335 hats by style (1)

Tài liệu Presented by: Group 1- Foreign Trade 2 pdf

Tài liệu Presented by: Group 1- Foreign Trade 2 pdf
... zone, Chau Thanh Dist., Tien Giang province, Vietnam Phone number (+84.73) 395 322 3 - 3854080 Fax number (+84.73) 38540 42 Website www.vietphu.com.vn Feature Exporting Aquatic Product (main product: ... o Turnover : 800 million VND o Export Market : + America : 40,59% + Australia : 15, 72% + Netherlands : 10 ,2% + China : 11,78% www.themegallery.com Strong points:  Source material is abundant ... www.themegallery.com Viet Phu’s Introduction: PRODUCTION  Agriculture : - Processing Capacity : 20 ,000 tones of Raw Cashew Nut per year - The quality of product is inspected in conformity with...
  • 24
  • 226
  • 0

Tài liệu Báo cáo khoa học: Gene transcription of fgl2 in endothelial cells is controlled by Ets-1 and Oct-1 and requires the presence of both Sp1 and Sp3 pdf

Tài liệu Báo cáo khoa học: Gene transcription of fgl2 in endothelial cells is controlled by Ets-1 and Oct-1 and requires the presence of both Sp1 and Sp3 pdf
... respectively Mutation of the Ets-1 binding site (mut5) also blocked the effect of Ets-1 in the presence of Sp1/ Sp3 Effect of the fgl2 positive regulatory region on induced expression of fgl2 Previously, ... for the basal expression of the fgl2 gene This finding is consistent with the observation that fgl2 is constitutively expressed in cultured endothelial cells, as well as in the primary endothelial ... contain fgl2 promoter all the way to the beginning of ATG start codon to avoid the discrepancy of minor transcription start variance between macrophages and endothelial cells Endothelial cells...
  • 13
  • 184
  • 0

Báo cáo khoa học: Signalling and regulation of collagen I synthesis by ET-1 and TGF-b1 doc

Báo cáo khoa học: Signalling and regulation of collagen I synthesis by ET-1 and TGF-b1 doc
... values TGF-b1 signalling was affected similarly, with no effect by inhibiting PLC-b (Fig 5A), strong down -regulation of collagen I levels after inhibition of PC-PLC (Fig 5B), and similar collagen I ... subunit of Gai [45] was inhibited specifically by U73122 [46] Inhibiting PLC-b by U73122 did not alter ET-1- induced collagen I synthesis, nor did it influence basal or TGF-b1- stimulated collagen I ... investigations should reveal if ET-1 elicits induced collagen I synthesis solely via induction of CTGF or via additional mechanisms as it is the case for TGF-b1 stimulation [2,55] In contrast to ET-1, ...
  • 13
  • 191
  • 0

báo cáo hóa học: " Apolipoprotein E expression is elevated by interleukin 1 and other interleukin 1-induced factors" ppt

báo cáo hóa học:
... Apolipoprotein E expression is elevated by interleukin and other interleukin 1- induced factors Ling Liu1; Orwa Aboud1; Richard A Jones1; Robert E Mrak4; W Sue T Griffin1-3*; Steven W Barger1-3 ... Levels of glutamate released into neuronal culture medium was elevated by IL -1 (Fig 5A) Likewise, IL -1 elevated the levels of sAPP in the culture medium of primary neurons in a dose-dependent ... have consequences 11 for ApoE expression Differences in this expression may be critical, considering the role of APOE genotype in AD risk The response of ApoE to IL -1 we show here in rodent brain...
  • 27
  • 92
  • 0

Báo cáo hóa học: " Down-regulation of cell surface CXCR4 by HIV-1" pdf

Báo cáo hóa học:
... in down-regulation of CXCR4 from the cell surface CXCR4 down-regulation may be due in part to intracellular sequestering of HIV glycoprotein/ CXCR4 complexes Methods Cells and virus Cells of ... between a lack of Env expression and expression of CXCR4 in cells of the induced cultures The distribution of CXCR4 on the minor population of induced Jurkat cells (...
  • 10
  • 150
  • 0

Báo cáo hóa học: " Differential control of CXCR4 and CD4 downregulation by HIV-1 Gag" docx

Báo cáo hóa học:
... physiology and HIV-1 biology, we have examined the role of ESCRT I in downregulation of these two cellular proteins SDF-1-induced downregulation of CXCR4 and PMA-induced downregulation of CD4 were ... whether downregulation of other receptors is sensitive to HIV-1 Gag expression, we have now investigated the kinetics of lysosomal downregulation of CD4 and CXCR4, in the presence and absence of Gag ... this study, we show that HIV-1 Gag, as well as TSG101, differentially affect the kinetics of downregulation of the HIV-1 co-receptors CXCR4 and CD4 SDF-1-induced CXCR4 downregulation was sharply...
  • 14
  • 124
  • 0

Báo cáo hóa học: " Alterations in intracellular potassium concentration by HIV-1 and SIV Nef" pptx

Báo cáo hóa học:
... in intracellular K+ and SIV Nef protein Alterations recombinant HIV- 1in T-lymphoblastoid cells incuAlterations in intracellular K+ in T-lymphoblastoid cells incubated with recombinant HIV-1 and ... cytostatic and cytotoxic against both CD4+ T cells and monocytoid cell lines [25] Several viral proteins, including influenza A virus M2, influenza B virus NB, HIV-1 Env, Vpu, and Vpr, induce alterations ... cells incubated with recombinant SIV Nef also reduced intracellular [K+] (not shown) In contrast, H9 cells incubated with Nef maintained intracellular pH at a similar level to that of mock-infected...
  • 6
  • 113
  • 0

Learning by doing 1 ppt

Learning by doing 1 ppt
... LEARNING BY DOING If the Personal Computer Is Old Hat to You Discover new ways to use the computer in ... Learner” provides fun and effective exercises for developing your kinesthetic study skills LEARNING BY DOING A NOTHER A CTIVE L EARNING T ECHNIQUE Experienced active learners think ahead before ... their own rate of learning And it varies, depending on what it is you’re learning When you’re developing a time-management study plan, you need to keep in mind how you learn 41 ...
  • 6
  • 51
  • 0

Báo cáo y học: "The induction of CCN2 by TGFβ1 involves Ets-1" ppsx

Báo cáo y học:
... addition of Ets-1 potentiates the TGFβ1 induction of CCN2 promoter activity (*p < 0.05), Fli-1 limits the TGFβ induction of CCN2 promoter activity relative to the induction of CCN2 promoter activity ... CCN2, TGFβ induction of tenascin-C is potentiated by Ets1; however, the TGFβ -induction of type I collagen is impaired by Ets-1 [30,34,42] Given that Ets-1 is induced during the early phases of ... Ets-1/Smad3 synergy Addition of the general PKC inhibitor bisindolylmaleimide I (bis; 10 µM) blocks the ability of Ets-1 to activate the CCN2 promoter Conversely, addition of bisindolylmaleimide...
  • 9
  • 170
  • 0

Báo cáo y học: "Peroxisome proliferator-activated receptor γ1 expression is diminished in human osteoarthritic cartilage and is downregulated by interleukin-1β in articular chondrocytes" doc

Báo cáo y học:
... Activation of peroxisome proliferator-activated receptor γ inhibits interleukin-1β- induced membraneassociated prostaglandin E2 synthase-1 expression in human synovial fibroblasts by interfering with Egr-1 ... induced arthritis [51] It is therefore tempting to speculate that diminished expression of PPARγ in OA cartilage may, at least in part, be involved in increased expression of inflammatory and catabolic ... demonstrate that human cartilage expresses predominantly PPARγ1 mRNA and that the levels of PPARγ1 are decreased in OA in comparison with normal cartilage Our immunohistochemistry analysis showed that...
  • 11
  • 192
  • 0

Báo cáo y học: "Comparison of metal-dependent catalysis by HIV-1 and ASV integrase proteins using a new and rapid, moderate throughput assay for joining activity in solution" ppt

Báo cáo y học:
... solution assay for integrase joining Moderate- throughput solution assay for integrase joining activity Panel A Principles of a solution assay to measure integrase joining activity by fluorescence Labeling ... presence of Mg++ Discussion The joining assay In this report we describe a simplified assay measuring the joining activity for retroviral integrases in solution The assay offers several advantages ... same in the two proteins Finally, the rate of joining by ASV IN is 6–7 fold faster than HIV-1 IN in the presence of either metal cofactor We also demonstrated the utility of the joining assay...
  • 10
  • 194
  • 0

Báo cáo y học: "Cell cycle G2/M arrest through an S phase-dependent mechanism by HIV-1 viral protein R." pps

Báo cáo y học:
... transduction by flow cytometric analysis (A) Expression of endogenous or siRNA-resistant Chk1 constructs from indicated cell lines was confirmed by Western blot analysis using anti-Chk1 antibody ... Discussion In this report, by using a single cell cycle assay, we demonstrated that Vpr induces cell cycle G2 arrest through a rather unusual molecular mechanism Vpr causes cell cycle G2/M arrest, ... generally leads to S phase arrest, but not G2 arrest In another study, by using siRNA, a special isoform of PP2A was shown to play an essential role in the G2 arrest induced by Vpr in human cells Unlike...
  • 18
  • 51
  • 0

Báo cáo y học: "Expression of a protein involved in bone resorption, Dkk1, is activated by HTLV-1 bZIP factor through its activation domain" potx

Báo cáo y học:
... TTAAACTTACCTAGACGGCGGACG; HBZ-S1-R, 5′-GCATGACACAGG CAAGCATCGAAA; ACTB-F, 5′-ACCAACTGGGACGACATGGAGAAA; ACTBR, 5′-TAGCACAGCCTGGATAGCAACGTA The DKK1b primer pair was used for standard PCR amplification of ... HTLV-I antisense transcripts initiate in the 3’LTR and are alternatively spliced and polyadenylated Retrovirology 2006, 3:15 59 Murata K, Hayashibara T, Sugahara K, Uemura A, Yamaguchi T, Harasawa ... this article as: Polakowski et al.: Expression of a protein involved in bone resorption, Dkk1, is activated by HTLV-1 bZIP factor through its activation domain Retrovirology 2010 7:61 Submit your...
  • 16
  • 175
  • 0

Báo cáo y học: "Tat RNA silencing suppressor activity contributes to perturbation of lymphocyte miRNA by HIV-1" ppsx

Báo cáo y học:
... Tat RNA silencing suppressor activity contributes to perturbation of lymphocyte miRNA by HIV-1 Retrovirology 2011 8:36 Submit your next manuscript to BioMed Central and take full advantage of: ... in miRNA profile is observed by ablation of Vpr/Vif The possibility that HIV-1 manipulation of host miRNA contributes to HIV-1 induced cell cycle delay was posited by the prominent role of miRNA ... RSS activity affects expression of a subset of miRNA This study determined that perturbation of miRNA expression by HIV-1 is largely independent of vif/vpr and Tat RSS activity in culture lymphocytes...
  • 13
  • 173
  • 0

Xem thêm

Từ khóa: Chuyên chở hàng hóa XNK bằng đường hàng khôngChiến Lược Phát Triển Công Nghệ Thông Tin Ở Việt Nam, Tầm Quan Trọng Của Công Nghệ Thông Tin, Vai Trò Quản Lý Nhà Nước Đối Với Công Nghệ Thông TinCông Cụ Tham Vấn Sự Phù Hợp Và Tính Hiệu QuảHoạt Động Giám Sát Của Quốc Hội Và Vai Trò Của Đại Biểu Quốc Hội Trong Hoạt Động Giám SátGiáo Dục Thể Chất Cho Trẻ Khiếm Thị Mầm NonKế Hoạch Tăng Cường Năng Lực Quản Lý Đào Tạo, Chỉ Đạo Tuyến Và Xây Dựng Kế Hoạch Đào Tạo, Chuyển Giao Kỹ Thuật Năm 2016Cơ chế lây truyền bệnhTuyển tập 36 đề thi thử THPT quốc gia môn hóa – thầy tào mạnh đứcBÁO CÁO THNN Công tác tuyển dụng nguồn nhân lựcTính tiên phong đi trước đối thủ trong các hoạt động kinh doanh của doanh nhân việt namMẸO THI BẰNG XE MÁY CÓ KÈM THEO PHẦN MỀM TEST.Cách làm hồ sơ đăng ký thi THPT quốc gia năm 2017Chuyên đề và phương pháp giải các định luật bảo toàn ( vật lý lớp 10)Đề thi HSG Toán 9 cấp Tỉnh 2017 có đáp án Sở GDĐT Quảng Ninhgiáo án thể dục lớp 3 tuần 26Quản lý xã hội đối với dân di cư tự do ở huyện krông bông, tỉnh đắk lắk hiện nayTÀI LIỆU CHUYÊN đề các GIAI đoạn PHÁT TRIỂN của CHỦ NGHĨA xã hội KHOA họcTÀI LIỆU CHUYÊN đề CÁCH MẠNG xã hội CHỦ NGHĨA và một số vấn đề có TÍNH QUY LUẬT của CÁCH MẠNG xã hội CHỦ NGHĨATÀI LIỆU CHUYÊN đề CON NGƯỜI và PHÁT HUY NHÂN tố CON NGƯỜI TRONG sự NGHIỆP xây DỰNG và bảo vệ tổ QUỐC xã hội CHỦ NGHĨACác bài tiểu luận văn tiếng anh
Nạp tiền Tải lên
Đăng ký
Đăng nhập