Intermediate dialogues with multiple choice quesitions a cookie

Báo cáo khoa học: "Discourse Processing of Dialogues with Multiple Threads" pot

Báo cáo khoa học:
... Development of our discourse processor was based on a corpus of 20 spontaneous Spanish scheduling dialogues containing a total of 630 sentences These dialogues were transcribed and then parsed with ... separate evaluation with the same set of dialogues, performance in terms of attaching the current chain of inference to the correct place in the plan tree for the purpose of augmenting temporal ... structure of discourses with multiple threads in a perspicuous manner While this study only explores the structure of negotiation dialogues, its results have implications for other types of discourse...
  • 8
  • 105
  • 0

Báo cáo y học: " Concomitant homozygosity for the prothrombin gene variant with mild deficiency of antithrombin III in a patient with multiple hepatic infarctions: a case report" pdf

Báo cáo y học:
... et al., Concomitant homozygosity for the prothrombin gene variant with mild deficiency of antithrombin III in a patient with multiple hepatic infarctions: a case report Journal of Medical Case ... affecting the liver A hepatic infarction is rare because of the richly anastamosing collateral arterial supply, and the dual blood supply from the portal vein and hepatic artery In this case, there ... mutation and paroxysmal nocturnal hae- Page of moglobinuria were all negative He was found to be homozygous for the prothrombin G2021 0A mutation with mild deficiency for antithrombin III (AT III...
  • 3
  • 148
  • 0

Báo cáo khoa học: "Case report: severe heat stroke with multiple organ dysfunction – a novel intravascular treatment approach" doc

Báo cáo khoa học:
... gastric lavage treatment of heatstroke: comparative efficacy in a canine model Crit Care Med 1987, 15:748-750 Megarbane B, Resiere D, Delahaye A, Baud FJ: Endovascular hypothermia for heat stroke: ... TNF alpha and IL levels in a patient with heat stroke Parameters Normal range, pg/ml Measured values on day 3, pg/ml sIL-2R 0–4 .8 1500 IL-4 NA IL-6 0–3 204 IL-8 NA 40 TNF alpha 0–2 0 Measured values ... may be an indicator that intravascular cooling and maintenance of normothermia influ- ences the inflammatory response and may lead to improved outcome in patients with heat stroke Conclusion Heat...
  • 4
  • 86
  • 0

Báo cáo khoa học: EmbR, a regulatory protein with ATPase activity, is a substrate of multiple serine⁄threonine kinases and phosphatase in Mycobacterium tuberculosis doc

Báo cáo khoa học: EmbR, a regulatory protein with ATPase activity, is a substrate of multiple serine⁄threonine kinases and phosphatase in Mycobacterium tuberculosis doc
... ethambutol Nat Med 3, 567–570 30 Amemura M, Makino K, Shinagawa H & Nakata A (1990) Cross talk to the phosphate regulon of Escherichia coli by PhoM protein: PhoM is a histidine protein kinase and catalyzes ... kinases PknF and PknG of Mycobacterium tuberculosis: characterization and localization Microbiology 147, 2307–2314 12 Gopalaswamy R, Narayanan PR & Narayanan S (2004) Cloning, overexpression, and ... heat-inactivated Mstp) in phosphatase buffer Incubation with Mstp resulted in 73% and 79% dephospho- Autoradiogram Autoradiogram Phosphorylated forms of PknH and EmbR are substrates of Mstp in...
  • 11
  • 126
  • 0

Báo cáo khoa học: CmtR, a cadmium-sensing ArsR–SmtB repressor, cooperatively interacts with multiple operator sites to autorepress its transcription in Mycobacterium tuberculosis pptx

Báo cáo khoa học: CmtR, a cadmium-sensing ArsR–SmtB repressor, cooperatively interacts with multiple operator sites to autorepress its transcription in Mycobacterium tuberculosis pptx
... TGTTATACCAGTATATGGTGTACTA CTCGGCCTCAACTACAGTCGT ACAGGTAGCTGAGCAGCAGAC CAGCTAGCTGGCCGGGATAGC P1F P1R GCCGATCATATCTGCTATGG CCATAGCAGATATGATCGGC P2F P2R ATGTACAATTCAGCTCTTGCT AGCAAGAGCTGAATTGTACAT ... P3F P3R GCTGTTATACCAGTATATGG CCATAT ACTGGTATAACAGC P4F P4R TGGTGTACTAATTTGATCTATG CATAGATCAAATAGTACACCA H1 CGAGTCGACCGGAGGACCTTT GGCCCTGCGTCGACCGA TCGGTCGACGCAGGGCCAAAG GTCCTCCGGTCGACTCG H2 Experiment ... TGAACA-AA-TATTCATAT) within the 49 bp of protected DNA [20] SmtB has been proposed to interact with two hyphenated imperfect inverted repeats (6-2-6, TGAACA-GT-TATTCA and 7-2-7, CTGAA TC-AA-GATTCAG)...
  • 12
  • 140
  • 0

báo cáo hóa học: " Soluble HLA measurement in saliva and cerebrospinal fluid in Caucasian patients with multiple sclerosis: a preliminary study" pdf

báo cáo hóa học:
... measurement of soluble HLA- I and soluble HAL-II Drs Minagar and Kelley have contributed to this manuscript by recruiting and examining multiple sclerosis patients, interpretation of data and preparing the ... significant Results All normal individuals tested had measurable amounts of sHLA-II in the saliva with a range of 186–362 unit/ml and a mean of 222 ± 18 unit/ml (Table-1) In saliva, sHLA-I levels ranged ... present in very low quantities, in the urine, sweat, saliva and tears of normal individuals sHLA-I is highly elevated in the saliva of patients with autoimmune rheumatic diseases [2,10] sHLA-II...
  • 7
  • 108
  • 0

Báo cáo hóa học: " Research Article A Low-Complexity LMMSE Channel Estimation Method for OFDM-Based Cooperative Diversity Systems with Multiple Amplify-and-Forward Relays" docx

Báo cáo hóa học:
... system with multiple AF relays CONCLUSIONS In this paper, a training-sequences-aided LMMSE channel estimation method has been proposed for OFDM-based cooperative diversity systems with multiple AF ... propose a training-sequences-aided LMMSE channel estimation method for OFDM-based cooperative diversity systems with multiple AF relays over frequency-selective block-fading channels First, the mean ... METHOD 3.1 LMMSE channel estimation method This subsection proposes a training-based method for channel estimation of multiple AF-relays-assisted cooperative diversity systems in the simple bandwidth-efficient...
  • 9
  • 78
  • 0

Multiple choice questions about Marketing with answers

Multiple choice questions about Marketing with answers
... turns marketing strategies and plans into marketing actions in order to accomplish strategic marketing objectives is called: a Marketing strategy b Marketing control c Marketing analysis d Marketing ... that a company's marketing should support the best long-run performance of the marketing system a Enlightened marketing b Myopic marketing c Fundamental marketing d Conceptual marketing 88 A company ... enlightened marketing that requires that a company seek real product and marketing improvements a Innovative marketing b Consumer-oriented marketing c Value marketing d Sense-of-mission marketing...
  • 43
  • 462
  • 2

báo cáo khoa học: "Bilateral adrenocortical carcinoma in a patient with multiple endocrine neoplasia type 1 (MEN1) and a novel mutation in the MEN1 gene" potx

báo cáo khoa học:
... adrenocortical carcinoma in a patient with multiple endocrine neoplasia type (MEN1) and a novel mutation in the MEN1 gene World Journal of Surgical Oncology 2 011 9:6 Submit your next manuscript ... WF, Burns AL, Spiegel AM, Marx SJ: Multiple endocrine neoplasia type 1: new clinical and basic findings Trends Endocrinol Metabol 20 01, 12 :17 3 -17 8 24 Chandrasekharappa SC, Guru SC, Manickam P, Olufemi ... neoplasia type J Surg Oncol 2005, 89 :14 3 -15 0 11 Carrasco CA, González AA, Carvajal CA, Campusano C, Oestreicher E, Arteaga E, Wohllk N, Fardella CE: Novel intronic mutation of MEN1 gene causing familial...
  • 7
  • 144
  • 0

báo cáo khoa học: "Lenalidomide induced good clinical response in a patient with multiple relapsed and refractory Hodgkin''''s lymphoma" pptx

báo cáo khoa học:
... Lactate dehydrogenase (U/L) < 241 250 175 Aspartate aminotransferase (U/L) 8-30 20 16 Alanine aminotransferase (U/L) 10-36 16 Gamma-glutamyl transpeptidase (U/L) 9-35 15 10 Alkaline phosphatase ... Metabolic activity was detected in the lungs and abdominal lymph nodes The patient has remained on continuous lenalidomide since 2008 In a follow-up examination in August 2009 she was found to be in good ... Kolonic, Lenalidomide induced good clinical response in a patient with multiple relapsed and refractory Hodgkin's lymphoma Journal of Hematology & Oncology 2010, 3:20 Page of ...
  • 3
  • 76
  • 0

báo cáo khoa học: " Primary adenocarcinoma of the stomach in von Recklinghausen’s disease with high serum levels of multiple tumor markers: a case report" ppsx

báo cáo khoa học:
... complicating peripheral neurofibromatosis [1,3], few cases have explored the association of primary infiltrating adenocarcinoma of the stomach [5] It has been indicated that loss of function of the NF-1 ... Immunohistochemical determination of AFP in the area of the adenocarcinoma was negative (×100) Discussion NF-1, or von Recklinghausen’s disease, was first described in 1882 It is a relatively common autosomal ... gastric carcinoma These have shown significantly higher marker levels associated with gastric serosa invasion by the neoplasia and invasion of veins or lymphatic vessels into the gastric wall as well...
  • 5
  • 75
  • 0

báo cáo khoa học: "Oculomotor nerve palsy associated with bortezomib in a patient with multiple myeloma: a case report" pps

báo cáo khoa học:
... resonance imaging (MRI) of the brain and brain stem with and without contrast was carried out and the only finding was a focal enhancing area in the white matter of the right pons about 11 mm in Page ... this article as: Toema et al.: Oculomotor nerve palsy associated with bortezomib in a patient with multiple myeloma: a case report Journal of Medical Case Reports 2010 4:342 Submit your next manuscript ... Faisal Bin Fahed Street, P.O Box 30353, AlKhobar, 31952, Saudi Arabia Authors’ contributions HE analyzed and interpreted the patient data regarding multiple myeloma and was a major contributor in...
  • 4
  • 61
  • 0

Báo cáo y học: "Multiple metachronous malignancies, one patient with three primary malignancies: a case report" pps

Báo cáo y học:
... this patient may also be linked to her predisposition to malignancy Oxidative DNA damage is significantly increased in the trabecular meshwork of glaucoma patients One study found that Genotypes ... revealed sclerosis in the body of the fifth lumbar vertebra It was thought that this was possibly metastatic disease but a bone scan was reported as normal Mammograms done every year on the remaining ... Journal of Medical Case Reports 2007, 1:15 been treated for glaucoma with pilocarpine and timolol maleate and had had surgical treatments for a tubal ectopic gestation and also for carpal tunnel...
  • 5
  • 123
  • 0

Xem thêm

Nạp tiền Tải lên
Đăng ký
Đăng nhập