17858 you are a winner award (1)

you are a badass how to stop doubting your greatness jen sincero

you are a badass how to stop doubting your greatness   jen sincero
... for realities that are waaaaaaaay beneath what’s available to them Very few people are even aware of what’s available, however, because we live in a fear-based society that loves to get all uppity ... these tips can help you in all areas of your life How to get clear on who you are and what your calling is: BE THE ALIEN Imagine that you re an alien floating around in outer space and you suddenly ... someone parked a car on your chest, crushed under the realization that your life is zooming by and you have yet to start living it in a way that has any real meaning to you You may have heard stories...
  • 160
  • 383
  • 0

Imagine that you are a dog

Imagine that you are a dog
... chủ trở lại Tôi s a lần thời gian để nhắc nhở chủ mà làm nhiệm vụ Nếu nghe số tiếng ồn nhìn thấy người lạ, s a ầm ĩ Điều làm cho chủ nhân nghĩ chó biết lời Tôi biết cách thực l a dối chủ Nhưng ... với chủ Tôi chí hội để bắt tên trộm Trong ngắn hạn, chó may mắn, tự hào chủ Có lẽ sớm có hội tốt để hiển thị tổng thể tôi chăm sóc cho anh ...
  • 2
  • 12
  • 0

Practice Test Two PRACTICE WRITING TEST TWO Writing Task 1 You are advised to spend a maximum of 20 doc

Practice Test Two PRACTICE WRITING TEST TWO Writing Task 1 You are advised to spend a maximum of 20 doc
... 8) Check- 11 -15 'a conservative estimate' (paragraph 1) Q16 'biologically diverse storehouse of flora and fauna' (paragraph 3) Ex: Explanations E wealth of plants and animals Q20 'loss of biodiversity' ... average wage by to villagers Q26 11 -15 14 4 Professor Yunus hopes to interest existing aid organisations and in his latest plans Practice Test Four Reading Passage Questions 27 - 40 You are advised ... why did you join Do you read much? What you like to read? What else you like to in your spare time? 12 6 Practice Test Two Part 92-94 Thank you Now, please take this card I want you to speak for...
  • 24
  • 318
  • 0

7560 are you a healthy eater (1)

7560 are you a healthy eater (1)
... rice and pasta FATS make you strong and give you energy There are fats in meat, butter and cheese and oil VITAMINS are important for your eyes, your skin, your bones, your hair and for other parts ... because…………………………………” D Read about the foods we eat Do you eat all of the seven important things? Tell your partner CARBOHYDRATES give you energy There are carbohydrates in bread, sugar, potatoes, ... not a lot of it Here you can find diary product, chicken, fish, fruit And what about your answers? How much fruit you eat? The last group is green – GO You can eat how much you want Vegetables...
  • 3
  • 14
  • 0

unit 2 - Thank you(Section A 1, 2,3)

unit 2 - Thank you(Section A 1, 2,3)
... A (1, 2, 3) Thursday, 21 st October 20 10 Unit Two: Thank you Section A (1, 2, 3) Hello, Nam How are you? Fine, thanks Hi, Mai I’m fine, thank you And how are you? Thursday, 21 st October 20 10 Unit ... _, thank you Thursday, 21 st October 20 10 Unit Two: Thank you Section A (1, 2, 3) How are you , Alan? Fine, thanks Thursday, 21 st October 20 10 Unit Two: Thank you Section A (1, 2, 3) ... cột A với từ cột B cho phù hợp) Cột A Cột B Trả lời I a you 1- b How b am Mai 2- c Thank c are you ? 3- a Nice d to meet you 4- d Thursday, 21 st October 20 10 Unit Two: Thank you Section A (1, 2, ...
  • 21
  • 165
  • 0

Tài liệu Tiếng Anh lớp 1, 2 - Lesson eighteen (Bài 18) ARE WE...? ARE YOU...? ARE THEY...? pdf

Tài liệu Tiếng Anh lớp 1, 2 - Lesson eighteen (Bài 18) ARE WE...? ARE YOU...? ARE THEY...? pdf
... - Are we ? - , you are not - Are you ? - , we are - Are they ? - , they are not - Are we ? - , you are - Are you ? - , we are not - Are they ? - , they are ... are - Are they ? - , they are not - Are they ? - , they are - Are they ? - , they are not - Are they ? - , they are - Are they ? - , they are not - Are they ? - ... flowers? - No, they are not Are they trees? - Yes, they are Are they roses? - No, they are not Are they daisies? - Yes, they are Are they dogs? - No, they are not Are they cats? - Yes, they are Are...
  • 7
  • 183
  • 3

Tài liệu Báo cáo khoa học: Characterization of promoter 3 of the human thromboxane A2 receptor gene A functional AP-1 and octamer motif are required for basal promoter activity docx

Tài liệu Báo cáo khoa học: Characterization of promoter 3 of the human thromboxane A2 receptor gene A functional AP-1 and octamer motif are required for basal promoter activity docx
... Prm3 was performed using the mutator primers Kin175 (5¢-CACCAGAGCTACTTACA CTGAATTCCAGAATAATCACAAGCAAATC -3 ; sense primer) vs its complement generating pGL3b:Prm3aOCT)1*, pGL3b:Prm3abOCT)1* and ... Prm3aaAP)1*, pGL3e:Prm3aaAP)1*, pGL3b:Prm3aaaAP)1* and pGL3e:Prm3aaaAP)1* Mutation of the Oct-1 element with the sequence aaA TGCa to aaTTCCa (core bases shown in uppercase letters) centered at )1 23 within ... Prm3aab; pGL3b:Prm3aab & pGL3e:Prm3aab (Primer Kin160; 5¢-dGAGAGGTACCGCAAATCTTCTCTCGCC TCC -3 , corresponding to NTs )106 to )86) (8) Prm3aaa; pGL3b:Prm3aaa & pGL3e:Prm3aaa (Primer Kin161, 5¢-dGAGAGGTACCGCAGCATCGGCCTGATG...
  • 18
  • 156
  • 0

Tài liệu Báo cáo khoa học: "Automatic Satire Detection: Are You Having a Laugh?" ppt

Tài liệu Báo cáo khoa học:
... and punctuation sequences (e.g a comma, or a closing quote mark followed by a period) are treated as separate features Method 3.1 Standard text classification approach 3.2 Targeted lexical features ... that informal language is much more common to satirical articles We measure the informality of an article as: def ∑ s(t) i = |T | t∈T Lexical approaches are clearly inadequate if we assume that ... Table The baseline is a naive classifier that assigns all instances to the positive where ¯ and σ are, respectively, the mean and stani dard deviation of i across all articles http://search.cpan.org/perldoc?...
  • 4
  • 135
  • 0

You Are Not a Gadget: A Manifesto (Vintage)

You Are Not a Gadget: A Manifesto (Vintage)
... department as Rapture images are in an evangelical bookstore (Just in case you are not familiar with the Rapture, it is a colorful belief in American evangelical culture about the Christian apocalypse ... Turks and Armenians, elders and kids, Israelis and Palestinians, rich professionals and struggling artists, formal academics and bohemian street musicians, all talking with one another about a shared ... until you find a computer that runs the hailstorm data as a program equivalent to your brain How you know when you ve found a match? There are endless options For mathematical reasons, you can never...
  • 129
  • 149
  • 0


... (identify any resources used in preparation of business plan) 13 Appendix (general background data, research data, additional financial data, marketing materials, etc.) 2013 FIRST NATIONAL BANK BUSINESS ... neat, legible, visually appealing and complete and accurate information about your business • The business plan may not contain fabricated information about backgrounds, experience, educational ... in mind that the judges reading your plan not know any background information about you or your business idea • Use simple language Keep your plan easy to read and easy to understand • Don’t depend...
  • 10
  • 153
  • 0

You are advised to spend a maximum of 20 minutes on this task docx

You are advised to spend a maximum of 20 minutes on this task docx
... Figure it can be seen that the flu was responsible for the deaths of females but no males in the period from March to May However, from June to August, there were female deaths and male death According ... According to the pie chart in Figure 2, only those females most at risk were given the new flu vaccine; 28% did not take part in the trial Of those females who took part, 35% were aged (over 65 years ... were babies or children; and 13% were either hospitalised or receiving other medical attention From Figure it is clear that the new vaccine had a positive effect on the number of new cases of flu...
  • 2
  • 136
  • 0

great PEOPLE DECISIONS Why They Matter So Much, Why They Are So Hard, and How You Can Master Them phần 1 ppt

great PEOPLE DECISIONS Why They Matter So Much, Why They Are So Hard, and How You Can Master Them phần 1 ppt
... Page i GREAT PEOPLE DECISIONS ffirs.qxd 5 /11 /07 2: 01 PM Page ii ffirs.qxd 5 /11 /07 2: 01 PM Page iii GREAT PEOPLE DECISIONS Why They Matter So Much, Why They Are So Hard, and How You Can Master Them ... 5 /11 /07 2: 01 PM Page iii GREAT PEOPLE DECISIONS Why They Matter So Much, Why They Are So Hard, and How You Can Master Them CLAUDIO FERNANDEZ ARAOZ John Wiley & Sons, Inc ffirs.qxd 5 /11 /07 2: 01 ... Cataloging-in-Publication Data: Fernández-Aráoz, Claudio Great people decisions : why they matter so much, why they are so hard, and how you can master them / Claudio Fernández-Aráoz p cm Includes bibliographical...
  • 36
  • 125
  • 0

Xem thêm

Đăng ký
Đăng nhập