58904 prompts for a speaking activity 6

An investigation into students’ conversational needs and some suggestions for a speaking syllabus to the 2nd year english bachel

An investigation into students’ conversational needs and some suggestions for a speaking syllabus to the 2nd year english bachel
... designing a syllabus are illustrated as follows Needs analysis-Objectives and aims-Sequencing–Teaching method–Testing and evaluation As a result, analyzing the needs of learners is the first and the foremost ... able to learn the foreign language as a means for close communication and acceptance by people who speak it Learners with instrumental motivation may learn a foreign language for an intermediate ... official and fixed syllabus; on the other hand, the current syllabus seems not satisfied with the students’ conversational needs Thus, analyzing the students’ needs to design an appropriate speaking...
  • 43
  • 196
  • 1

Tài liệu Activity 6.3: Determining a Preliminary Activity 6.3: Determining a Preliminary Network Topology pdf

Tài liệu Activity 6.3: Determining a Preliminary Activity 6.3: Determining a Preliminary Network Topology pdf
... 44 Activity 6.3: Determining a Preliminary Distribution of Services Across a Network Topology Exercise 1: Determining the Deployment of Service Types ! Determine a preliminary distribution ... of services Participate in small groups as assigned by the instructor Review the Ferguson and Bardell, Inc case study Review the network topology on this page Indicate where particular service ... by writing a "U" for user services, "B" for business services, and "D" for data services at each machine with the service type that you expect to reside there After completing the above steps,...
  • 2
  • 129
  • 0

Tài liệu Essay Writing for a Score of 6.0 on the TOEFL and TWE pdf

Tài liệu Essay Writing for a Score of 6.0 on the TOEFL and TWE pdf
... - they can learn about responsibility, - they can learn the value of money, - they can learn how to work as a member of a team B Body of the Essay Now you expand on the reasons you gave in the ... paragraph Typically, a TOEFL/ TWE essay will have - body paragraphs C The conclusion: The conclusion will be your final paragraph It will summarize all the main ideas in your essay and it may also include ... how to answer them The readers will also judge essays on how the ideas are presented or organized and developed as well as on the use of language Essays are judged on organization If an essay is...
  • 23
  • 291
  • 0

Tài liệu Academic Writing A Handbook for International Students part 6 docx

Tài liệu Academic Writing A Handbook for International Students part 6 docx
... information reason The way we use banks This is partly because The personal computer At the same time banks In the past five years The banks have discovered a) A paragraph is a collection ... crowded, and overworked teachers are less able to give students personal attention 1.12 Organising Paragraphs Paragraphs are the basic building blocks of texts Well-organised paragraphs not ... time banks are being reorganised in ways that affect both customers and staff In the past five years over 3,000 bank branches have closed in Britain The banks have discovered that staffing call centres...
  • 10
  • 258
  • 0

Tài liệu Activity 6.2: Optimizing a Physical Data Design pptx

Tài liệu Activity 6.2: Optimizing a Physical Data Design pptx
... to the main SQL Server database daily Create a separate database and table for the client computers that only accept timesheet data Replicate this data to the main database as needed Management ... 36 Activity 6.2: Optimizing a Physical Data Design Exercise 1: Determining Areas for Optimization In this exercise, you will evaluate the logical data design presented in the following illustration, ... situation has been identified as a performance problem by the database administrators, and they are requesting a fix as soon as possible (The field is already indexed.) Solutions can vary Denormalize...
  • 4
  • 136
  • 0

Tài liệu Báo cáo khoa học: Characterization of promoter 3 of the human thromboxane A2 receptor gene A functional AP-1 and octamer motif are required for basal promoter activity docx

Tài liệu Báo cáo khoa học: Characterization of promoter 3 of the human thromboxane A2 receptor gene A functional AP-1 and octamer motif are required for basal promoter activity docx
... Prm3 was performed using the mutator primers Kin175 (5¢-CACCAGAGCTACTTACA CTGAATTCCAGAATAATCACAAGCAAATC -3 ; sense primer) vs its complement generating pGL3b:Prm3aOCT)1*, pGL3b:Prm3abOCT)1* and ... Prm3aaAP)1*, pGL3e:Prm3aaAP)1*, pGL3b:Prm3aaaAP)1* and pGL3e:Prm3aaaAP)1* Mutation of the Oct-1 element with the sequence aaA TGCa to aaTTCCa (core bases shown in uppercase letters) centered at )1 23 within ... Prm3aab; pGL3b:Prm3aab & pGL3e:Prm3aab (Primer Kin160; 5¢-dGAGAGGTACCGCAAATCTTCTCTCGCC TCC -3 , corresponding to NTs )106 to )86) (8) Prm3aaa; pGL3b:Prm3aaa & pGL3e:Prm3aaa (Primer Kin161, 5¢-dGAGAGGTACCGCAGCATCGGCCTGATG...
  • 18
  • 195
  • 0

Tài liệu Báo cáo khoa học: Experimental proof for a signal peptidase I like activity in Mycoplasma pneumoniae, but absence of a gene encoding a conserved bacterial type I SPase pdf

Tài liệu Báo cáo khoa học: Experimental proof for a signal peptidase I like activity in Mycoplasma pneumoniae, but absence of a gene encoding a conserved bacterial type I SPase pdf
... protein, additional information about post-translational modifications, like 2895 Signal peptidase I activity in M pneumoniae Fig SIGNAL P predicted and experimentally verified cleavage site for P40 ... N-terminal part of the peptide, it is evident that the N-terminal amino acid is asparagine (position 26), but increased in mass by 136 Da Because this modification is only possible at the free a amino ... although a SPase I activity has been shown to be essential for cell viability in all bacteria analyzed [26] To test experimentally whether there is a type I SPase activity in M pneumoniae, we determined...
  • 9
  • 219
  • 0

Báo cáo khoa học: The benzophenanthridine alkaloid sanguinarine perturbs microtubule assembly dynamics through tubulin binding A possible mechanism for its antiproliferative activity Manu Lopus and Dulal Panda docx

Báo cáo khoa học: The benzophenanthridine alkaloid sanguinarine perturbs microtubule assembly dynamics through tubulin binding A possible mechanism for its antiproliferative activity Manu Lopus and Dulal Panda docx
... (13-methyl-[1,3]-benzodioxolo[5,6-c]1,3-dioxolo-[4,5-i]-phenanthridinium chloride) (Fig 1), a benzophenanthridine alkaloid derived from the plant Sanguinaria canadensis, has been shown to have antimicrobial, anti-inflammatory, antioxidant, and anticancer ... sanguinarine on the assembly of pure tubulin, the alkaloid inhibited the rate and extent of the assembly of microtubule protein, as measured by light scattering (Fig 5D) For example, 20 lm sanguinarine ... used the amount of sanguinarine precipitated at each concentration of sanguinarine in the presence of BSA as a background to correct the experimental data Effects of sanguinarine on tubulin ANS...
  • 12
  • 155
  • 0

Xem thêm

Từ khóa: ĐỀ KIỂM TRA HỌC KỲ MÔN HỆ QTCSDL SQL SERVERGiải pháp phát triển kinh tế hộ tại huyện đồng hỷ, tỉnh thái nguyênNghiên cứu nâng cao hiệu quả hệ thống tạo phôi in vitro ở lợnNghiên cứu vấn đề xác thực giao dịch ngân hàng trực tuyến sử dụng mật khẩu dạng OTPThiết kế và chế tạo bộ truyền bánh răng trụ răng cong trên máy CNC 4dĐề kiểm tra sql server 1Nâng cao năng lực cạnh tranh sản phẩm gạo điện biênBAO bì SINH học CHÍNH THỨC pdfNghiên cứu khả năng sinh trưởng, phát triển của một số giống ngô lai mới tại huyện đầm hà, tỉnh quảng ninhtài liệu công nghệ sản suất mắmchay từ quả dứaNghiên cứu xây dựng hồ sơ địa chính dạng số cho xã tân thịnh, huyện định hóa, tỉnh thái nguyênĐánh giá hàm lượng sắt và mangan trong nước sinh hoạt cấp từ nhà máy cấp nước diễn vọng thành phố hạ long bằng phương pháp phổ hấp thụ phân tửẢnh hưởng một số tổ hợp phân bón đến sinh trưởng và phát triển của giống lúa thiên ưu 8 vụ mùa 2015 và vụ xuân 2016 tại hoành bồ, quảng ninhThiết kế hệ tự chỉnh trong hệ thống điều khiển số tốc độ động cơ một chiềuĐiều khiển vector động cơ đồng bộ từ thông dọc trục trong hệ thống truyền động có tích hợp ổ đỡ từ hai đầu trụcHote survey executive summary 2014 VN báo cáo tóm tắt khảo sát ngành dịch vụ khách sạnBài giảng tin học 8Bộ đề luyện thi Violympic Toán lớp 4Làm chủ lý thuyết hoá học phần 2Quản trị Marketing Hoạch định chính sách sản phẩm
Nạp tiền Tải lên
Đăng ký
Đăng nhập