58904 prompts for a speaking activity 6

An investigation into students’ conversational needs and some suggestions for a speaking syllabus to the 2nd year english bachel

An investigation into students’ conversational needs and some suggestions for a speaking syllabus to the 2nd year english bachel
... designing a syllabus are illustrated as follows Needs analysis-Objectives and aims-Sequencing–Teaching method–Testing and evaluation As a result, analyzing the needs of learners is the first and the foremost ... able to learn the foreign language as a means for close communication and acceptance by people who speak it Learners with instrumental motivation may learn a foreign language for an intermediate ... official and fixed syllabus; on the other hand, the current syllabus seems not satisfied with the students’ conversational needs Thus, analyzing the students’ needs to design an appropriate speaking...
  • 43
  • 167
  • 1

Tài liệu Activity 6.3: Determining a Preliminary Activity 6.3: Determining a Preliminary Network Topology pdf

Tài liệu Activity 6.3: Determining a Preliminary Activity 6.3: Determining a Preliminary Network Topology pdf
... 44 Activity 6.3: Determining a Preliminary Distribution of Services Across a Network Topology Exercise 1: Determining the Deployment of Service Types ! Determine a preliminary distribution ... of services Participate in small groups as assigned by the instructor Review the Ferguson and Bardell, Inc case study Review the network topology on this page Indicate where particular service ... by writing a "U" for user services, "B" for business services, and "D" for data services at each machine with the service type that you expect to reside there After completing the above steps,...
  • 2
  • 118
  • 0

Tài liệu Essay Writing for a Score of 6.0 on the TOEFL and TWE pdf

Tài liệu Essay Writing for a Score of 6.0 on the TOEFL and TWE pdf
... - they can learn about responsibility, - they can learn the value of money, - they can learn how to work as a member of a team B Body of the Essay Now you expand on the reasons you gave in the ... paragraph Typically, a TOEFL/ TWE essay will have - body paragraphs C The conclusion: The conclusion will be your final paragraph It will summarize all the main ideas in your essay and it may also include ... how to answer them The readers will also judge essays on how the ideas are presented or organized and developed as well as on the use of language Essays are judged on organization If an essay is...
  • 23
  • 232
  • 0

Tài liệu Academic Writing A Handbook for International Students part 6 docx

Tài liệu Academic Writing A Handbook for International Students part 6 docx
... information reason The way we use banks This is partly because The personal computer At the same time banks In the past five years The banks have discovered a) A paragraph is a collection ... crowded, and overworked teachers are less able to give students personal attention 1.12 Organising Paragraphs Paragraphs are the basic building blocks of texts Well-organised paragraphs not ... time banks are being reorganised in ways that affect both customers and staff In the past five years over 3,000 bank branches have closed in Britain The banks have discovered that staffing call centres...
  • 10
  • 194
  • 0

Tài liệu Activity 6.2: Optimizing a Physical Data Design pptx

Tài liệu Activity 6.2: Optimizing a Physical Data Design pptx
... to the main SQL Server database daily Create a separate database and table for the client computers that only accept timesheet data Replicate this data to the main database as needed Management ... 36 Activity 6.2: Optimizing a Physical Data Design Exercise 1: Determining Areas for Optimization In this exercise, you will evaluate the logical data design presented in the following illustration, ... situation has been identified as a performance problem by the database administrators, and they are requesting a fix as soon as possible (The field is already indexed.) Solutions can vary Denormalize...
  • 4
  • 117
  • 0

Tài liệu Báo cáo khoa học: Characterization of promoter 3 of the human thromboxane A2 receptor gene A functional AP-1 and octamer motif are required for basal promoter activity docx

Tài liệu Báo cáo khoa học: Characterization of promoter 3 of the human thromboxane A2 receptor gene A functional AP-1 and octamer motif are required for basal promoter activity docx
... Prm3 was performed using the mutator primers Kin175 (5¢-CACCAGAGCTACTTACA CTGAATTCCAGAATAATCACAAGCAAATC -3 ; sense primer) vs its complement generating pGL3b:Prm3aOCT)1*, pGL3b:Prm3abOCT)1* and ... Prm3aaAP)1*, pGL3e:Prm3aaAP)1*, pGL3b:Prm3aaaAP)1* and pGL3e:Prm3aaaAP)1* Mutation of the Oct-1 element with the sequence aaA TGCa to aaTTCCa (core bases shown in uppercase letters) centered at )1 23 within ... Prm3aab; pGL3b:Prm3aab & pGL3e:Prm3aab (Primer Kin160; 5¢-dGAGAGGTACCGCAAATCTTCTCTCGCC TCC -3 , corresponding to NTs )106 to )86) (8) Prm3aaa; pGL3b:Prm3aaa & pGL3e:Prm3aaa (Primer Kin161, 5¢-dGAGAGGTACCGCAGCATCGGCCTGATG...
  • 18
  • 178
  • 0

Tài liệu Báo cáo khoa học: Experimental proof for a signal peptidase I like activity in Mycoplasma pneumoniae, but absence of a gene encoding a conserved bacterial type I SPase pdf

Tài liệu Báo cáo khoa học: Experimental proof for a signal peptidase I like activity in Mycoplasma pneumoniae, but absence of a gene encoding a conserved bacterial type I SPase pdf
... protein, additional information about post-translational modifications, like 2895 Signal peptidase I activity in M pneumoniae Fig SIGNAL P predicted and experimentally verified cleavage site for P40 ... N-terminal part of the peptide, it is evident that the N-terminal amino acid is asparagine (position 26), but increased in mass by 136 Da Because this modification is only possible at the free a amino ... although a SPase I activity has been shown to be essential for cell viability in all bacteria analyzed [26] To test experimentally whether there is a type I SPase activity in M pneumoniae, we determined...
  • 9
  • 179
  • 0

Báo cáo khoa học: The benzophenanthridine alkaloid sanguinarine perturbs microtubule assembly dynamics through tubulin binding A possible mechanism for its antiproliferative activity Manu Lopus and Dulal Panda docx

Báo cáo khoa học: The benzophenanthridine alkaloid sanguinarine perturbs microtubule assembly dynamics through tubulin binding A possible mechanism for its antiproliferative activity Manu Lopus and Dulal Panda docx
... (13-methyl-[1,3]-benzodioxolo[5,6-c]1,3-dioxolo-[4,5-i]-phenanthridinium chloride) (Fig 1), a benzophenanthridine alkaloid derived from the plant Sanguinaria canadensis, has been shown to have antimicrobial, anti-inflammatory, antioxidant, and anticancer ... sanguinarine on the assembly of pure tubulin, the alkaloid inhibited the rate and extent of the assembly of microtubule protein, as measured by light scattering (Fig 5D) For example, 20 lm sanguinarine ... used the amount of sanguinarine precipitated at each concentration of sanguinarine in the presence of BSA as a background to correct the experimental data Effects of sanguinarine on tubulin ANS...
  • 12
  • 137
  • 0

Xem thêm

Từ khóa: Khao sat dong dien xoay chieuGiáo trình tin học: Lập trình với Microsoft Visual Basic 6.0Phát hiện trùng lặp văn bản và xây dựng chỉ mục hiệu quả cho WebCrawler900 câu trắc nghiệm lớp 10 đại số và giải tíchĐồ án thiết kế bản vẽ thi công chung cư đông hưng 1, thành phố hồ chí minhGiới thiệu về thương mại điện tử và trang web LAZADAĐồ án kết cấu thép công trình có một tầng một nhịp hai cầu trụcDe HSG sinh 9 tuyển chọn hayĐề xuất các giải pháp tăng cường công tác quản lý chi phí các dự án tu bổ, duy tu bảo dưỡng đê điều tỉnh bắc ninhMột số giải pháp nâng cao hiệu quả quản lý đầu tư công trong chương trình nước sạch và vệ sinh môi trường nông thôn tại điện biênNghiên cứu áp dụng hệ thống quản lý chất lượng ISO 90012008 trong công tác thẩm định các công trình thủy lợi tại sở nông nghiệp và phát triển nông thôn tỉnh quảng bìnhĐề xuất giải pháp nâng cao chất lượng kiểm toán báo cáo quyết toán dự án xây dựng hoàn thành thuộc nguồn vốn nhà nước do công ty kiểm toán hà nội thực hiệnỨng dụng mô hình toán đánh giá khả năng cấp nước trên dòng chính lưu vực sông vu gia thu bồnNghiên cứu đề xuất giải pháp nâng cao năng lực trong đấu thầu các dự án sử dụng nguồn vốn vay ODA, áp dụng với dự án khôi phục, nâng cấp hệ thống thủy lợi bắc nghệ anĐề tài phân tích ứng xử của cấu kiện trong công trình chống động đấtNghiên cứu, đề xuất các giải pháp lựa chọn nhà thầu xây lắp cho dự án sử dụng vốn của ngân hàng thế giới (WB) do sở nông nghiệp và phát triển nông thôn tỉnh phú yên làm chủ đầu tưTình hình chăn nuôi lợn nái sinh sản và phòng trị bệnh phân trắng lợn con tại trại lợn nguyễn thanh lịch xã ba trại huyện ba vì thành phố hà nộiAmerican cuisine (liên hệ mình để nhận bản powerpoint)Báo cáo tính toán cụ thể công trình thực tế có 2 tầng hầm sử dụng cọc khoan nhồi tiết diện nhỏ làm tường vây và sử dụng cọc d600 làm móng cọcLuận văn thiết kế trụ sở văn phòng công ty cổ phần xây dựng số 5
Nạp tiền Tải lên
Đăng ký
Đăng nhập