43151 a play

FTTX Architecture Creating a Cost Effective Plug-and-Play FTTX Architecture

FTTX Architecture Creating a Cost Effective Plug-and-Play FTTX Architecture
... the FTTX network, installation and maintenance can be accomplished quickly and easily Additionally, easy access at the MST facilitates maintenance and troubleshooting by allowing technicians ... external surface enables easy connections without opening the enclosure Operational cost savings The MST hardened connector approach to any FTTX architecture provides huge operational cost advantages ... FTTX Architecture Creating a Cost Effective Plug-and-Play FTTX Architecture In any FTTX deployment, the goal of network planners is to build the most flexible and reliable system...
  • 4
  • 269
  • 0

Tài liệu Utilizing a plug-and-play architecture to drive down architecture to drive down docx

Tài liệu Utilizing a plug-and-play architecture to drive down architecture to drive down docx
... of installation, labor, and capital equipment costs makes it obvious that plug-and-play connectivity offers a tremendous advantage Advantage: plug-and-play The plug-and-play approach to an FTTP ... directly into a transceiver, such as with video equipment, is easy configuration, as only one cable is required to each shelf As always, even with plug-and-play architectures simplifying applications ... drop cables are factory-connectorized assemblies with hardened connectors on each end These cables are also pre-tested and certified at the factory to meet performance requirements Each hardened...
  • 4
  • 136
  • 0

Báo cáo khoa học: Trigger factor interacts with the signal peptide of nascent Tat substrates but does not play a critical role in Tat-mediated export pptx

Báo cáo khoa học: Trigger factor interacts with the signal peptide of nascent Tat substrates but does not play a critical role in Tat-mediated export pptx
... on the export of proteins that follow disparate targeting/translocation pathways In conclusion, the data suggest that TF, although interacting with Tat signal peptides, does not play a critical ... SufIHAXbaI+ClaI-rv (5¢-ACTGATCGATCTAGATTACGCAT AGTCAGGAACATCGTATGGGTAGCCGCCTGGCG GTACCGGATTGACCAAC-3¢, ClaI site underlined, XbaI site in italics, HA-epitope sequence in boldface) The resulting fragments ... pC4Meth-100TorA/P2 was constructed by PCR, using pTorA/P2 [17] as a template and the primers RRTorA-SacI-fw (5¢-GCGCGGAGCTCAAGAAGGA AGAAAAATAATGAAC-3¢, SacI site underlined) and TorA/Lep2-BamHI-rv (5¢-GCATGGATCCCGCGCGC...
  • 9
  • 201
  • 0

''''This Is Not a Game'''': Immersive Aesthetics and Collective Play pdf

''''This Is Not a Game'''': Immersive Aesthetics and Collective Play pdf
... stated) and legal disclaimers All of this peripheral information serves as a constant reminder that a game is being played Another barrier to player immersion in the Nokia Game is its reliance on ... mini-flash games to advance plot and player status These games, played on cell phones or the Web, have a symbolic diegetic meaning — for instance, a player manipulates an avatar through a flash ... social and political action The genre's repeated disavowals that "this is not a game" is more than a catchy tag line; it is a call for further study, development and deployment of immersive gaming's...
  • 10
  • 320
  • 0

a review of the play violet

a review of the play violet
... the audience somewhat confused ...
  • 2
  • 241
  • 0

Learning to play games or playing games to learn? A health education case study with Soweto teenagers pptx

Learning to play games or playing games to learn? A health education case study with Soweto teenagers pptx
... descendant of Vygotsky’s work, namely Cultural Historical Activity Theory (CHAT) can be used both as an analytical frame to design educational games and as a means to understand tool-mediated knowledge ... technological artifact acts as a tutor (learning from) Ten years after Amory et al (1999) reported that students found games educationally motivating, Papastergiou (2009) still reported that educational ... classroom, it was argued that games are mostly used as tutors, a learning from position rather than as tools to mediate learning, a learning with position When a game functions as a tutor it becomes...
  • 20
  • 248
  • 0

Báo cáo khoa học: Nuclear aggregates of polyamines are supramolecular structures that play a crucial role in genomic DNA protection and conformation potx

Báo cáo khoa học: Nuclear aggregates of polyamines are supramolecular structures that play a crucial role in genomic DNA protection and conformation potx
... Polyamine aggregates and DNA L D’Agostino et al Fig Interaction of single nuclear aggregates of polyamines (NAPs) with different DNA forms (A) Small-size NAP (s-NAP) interacting with A- DNA Grey ... 2005 FEBS L D’Agostino et al Polyamine aggregates and DNA A B Fig Nuclear aggregates of polyamines (NAPs) protect genomic DNA from DNase I and, at the same time, in uence DNA conformation The electrophoretic ... the charge attraction between DNA phosphates and the amino groups of polyamines As the amino groups of polyamines are already engaged in ionic bonds with the phosphates of NAPs, secondary amino...
  • 11
  • 210
  • 0

Báo cáo Y học: Does phosphorylation of the cap-binding protein eIF4E play a role in translation initiation? ppt

Báo cáo Y học: Does phosphorylation of the cap-binding protein eIF4E play a role in translation initiation? ppt
... 5357 an anabolic stimulus, may largely induce increased translation across the board of mRNAs that are already actively being translated How could increased phosphorylation of eIF4E actually inhibit ... i.e has a cap and a poly (A) -tail The open reading frame of the mRNA is shown as a thick line Initiation factors are abbreviated The arrow indicates the phosphorylation of eIF4E at Ser209 by the ... by the observations (a) that insulin activates protein synthesis in the absence of an increase in eIF4E phosphorylation [48] and (b) that the S20 9A mutant can support protein synthesis [64] In...
  • 10
  • 188
  • 0

a world without play literature review 2012

a world without play literature review 2012
... Community Play: A literature review London: Play England Available online at: http://www.playday.org.uk/PDF/Community -play -a- literature- review. pdf (Accessed Nov 2011) Graham, G, Holt-Hale, S A and Parker, ... Press Gleave, J (2008) Risk and Play: A literature review London: Play England Available online at: http://www.playday.org.uk/PDF/Risk-and -play -a- literature- review. pdf (Accessed Nov 2011) Gleave, ... Children’s Time to Play: A literature review London: Play England Available online at: http://www.playday.org.uk/pdf/Childrens-time-to -play -a- literature- review. pdf (Accessed Nov 2011) Gleave, J (2010)...
  • 34
  • 113
  • 0

Khóa luận tốt nghiệp tiếng anh: A study on using Role Play to motivate the 10th form students in speaking lessons at Lao Cai boarding upper secondary school, Lao Cai province –An experiment

Khóa luận tốt nghiệp tiếng anh: A study on using Role Play to motivate the 10th form students in speaking lessons at Lao Cai boarding upper secondary school, Lao Cai province –An experiment
... Role Play to motivate the 10th form students in speaking lessons at Lao Cai boarding upper secondary school, Lao Cai province –An experiment. ” 1.2 Hypothesis Using role play can increase students ... namely A study on using Role Play to motivate the 10th form students in speaking lessons at Lao Cai boarding upper secondary school, Lao Cai province –An experiment. The experiment lasted seven ... ABSTRACT The purpose of this study was to investigate the effects of using role play to motivate students in speaking lesson The research was carried out at Lao Cai boarding upper secondary...
  • 92
  • 1,459
  • 4

Xem thêm

Nạp tiền Tải lên
Đăng ký
Đăng nhập