22933 animals pets wild animals and farm animals

Tài liệu Báo cáo khoa học: Enzymatic properties of wild-type and active site mutants of chitinase A from Vibrio carchariae, as revealed by HPLC-MS pptx

Tài liệu Báo cáo khoa học: Enzymatic properties of wild-type and active site mutants of chitinase A from Vibrio carchariae, as revealed by HPLC-MS pptx
... 5¢-CAGCCGCCGTAGAAGTT GTAAGTCATCGCAAAG-3¢, 5¢-CGCCGCCACCAGGG AACATCCAGTCAATATCTAC-3, and 5¢-GCCGCCAC CAGGGAATTGCCAGTCAATATCTAC-3¢, respectively Confirmation of the mutated nucleotides by automated ... mutant, an additional faint band was also seen at an Mr of  43 000 This band appeared as a degradation product during freezing and thawing of the protein that was stored at )30 °C As revealed by ... investigated, such as the enzymatic reaction with chitinase A from V carchariae A combination of HPLC and ESI MS allowed the separation of a and b anomers and all chitooligosaccharide products to...
  • 11
  • 216
  • 0

Báo cáo khoa học: Molecular dynamics structures of peptide nucleic acidÆDNA hybrid in the wild-type and mutated alleles of Ki-ras proto-oncogene ppt

Báo cáo khoa học: Molecular dynamics structures of peptide nucleic acidÆDNA hybrid in the wild-type and mutated alleles of Ki-ras proto-oncogene ppt
... deciphering the origin of the destabilization and hence, diminution of the melting temperature (Tm) in the former Base stacking in the vicinity of A C mismatch in PNAÆDNA and DNA duplexes Intra strand ... stacking, fluctuating nature of the hydrogen bond and water organization in the vicinity of the mismatch might be the contributing factors for the increase in free energy and diminished stability of ... On the other hand, stacking at the AC(6–7) step in the DNA strand of PDwt is retained during the entire simulation in spite of the large movement of C7 (Fig 2A) This occurs due to the coordinated...
  • 16
  • 162
  • 0

Báo cáo khoa học: Insertion of the plant photosystem I subunit G into the thylakoid membrane In vitro and in vivo studies of wild-type and tagged versions of the protein doc

Báo cáo khoa học: Insertion of the plant photosystem I subunit G into the thylakoid membrane In vitro and in vivo studies of wild-type and tagged versions of the protein doc
... amplification with primers 5¢-GCGGAGCTCATGGCCAC AAGCGCATCAGC-3¢ and 5¢-GTGGTGGTGGTGGTGG TGGAAATGGGTTTTTCCGTTCTGC-3¢ (His-tag underlined) or 5¢-TGGAGCCACCCGCAGTTCGAAAAAGAA GCTGGAGATGATCGTGCT-3¢ (Strep-tag ... template Primers were designed as follows: PSAG with a C-terminal hexa-histidine tag (PSI -G- HisTerm), 5¢-GCGGAGCTCAT GGCCACAAGCGCATCAGC-3¢ and 5¢-GCGGCATGCT CAGTGGTGGTGGTGGTGGTGTCCAAAGAAGCTTG GGTCGTAT-3¢ ... shielded from trypsin digestion on the cis-side of the membrane The A B 4004 Fig Determination of the topology of PSI -G in the thylakoid membrane using in vitro import experiments (A) Insertion...
  • 9
  • 162
  • 0

Báo cáo Y học: Overexpression of a recombinant wild-type and His-tagged Bacillus subtilis glycine oxidase in Escherichia coli pptx

Báo cáo Y học: Overexpression of a recombinant wild-type and His-tagged Bacillus subtilis glycine oxidase in Escherichia coli pptx
... that GO and DAAO oxidize D-proline, D-alanine and D-2-aminobutyrate with similar relative efficiencies Analogously, GO and MSOX show a fairly similar activity on sarcosine and N-ethylglycine In ... possesses a wide substrate specificity In addition to sarcosine and glycine, even N-ethylglycine, ethylglycine ester, D-alanine, D-2-aminobutyrate, D-proline, D-pipecolate and N-methyl-D-alanine are ... then assayed using the standard O2 consumption assay at 25 °C Data are expressed as per cent of enzyme activity in the standard assay; the lines through the data points have been obtained by smooth...
  • 8
  • 176
  • 0

Báo cáo khoa học: Probing the active site of Corynebacterium callunae starch phosphorylase through the characterization of wild-type and His334fiGly mutant enzymes pot

Báo cáo khoa học: Probing the active site of Corynebacterium callunae starch phosphorylase through the characterization of wild-type and His334fiGly mutant enzymes pot
... 17-fold enhancement of GL binding to the wild-type upon the addition of the same concentration of phosphate pH profiles The pH dependences of logarithmic rates of the H334G mutant and wild-type are ... wild-type and with an optimum pH of 6.5 A shift of the pH profile of about + 0.5–1.0 pH units and an optimum pH similar to that of the wild-type was observed for the H334G mutant in the presence of 200 ... specific activities of the wild-type (33 UÆmg)1) and the H334G mutant (0.001 UÆmg)1) in the absence of imidazole P-NMR spectra for solutions of wild-type CcStP and the H334G mutant that contained...
  • 11
  • 153
  • 0

Báo cáo khoa học: Alternative substrates for wild-type and L109A E. coli CTP synthases Kinetic evidence for a constricted ammonia tunnel doc

Báo cáo khoa học: Alternative substrates for wild-type and L109A E. coli CTP synthases Kinetic evidence for a constricted ammonia tunnel doc
... wild-type and L10 9A CTP synthases to catalyse the hydrolysis of Gln, Gln-OH, and Gln-NH2 (i.e glutaminase activity) and to subsequently catalyse the formation of CTP, N4-hydroxy -CTP, and N4-amino -CTP, ... ịglutaminase activity 2ị Saturatingcouplingratioẳ kcat ịCTPformation kcat ịglutaminaseactivity 3ị For wild-type CTPS, these ratios are both unity for Gln and Gln-OH at subsaturating concentrations ... maintained at 0.30 M in all assays by the addition of KCl All kinetic parameters were determined in triplicate and average values are reported The reported errors are standard deviations Initial rate kinetic...
  • 9
  • 169
  • 0

Báo cáo khoa học: The relationship between thermal stability and pH optimum studied with wild-type and mutant Trichoderma reesei cellobiohydrolase Cel7A ppt

Báo cáo khoa học: The relationship between thermal stability and pH optimum studied with wild-type and mutant Trichoderma reesei cellobiohydrolase Cel7A ppt
... potassium phosphate buffer Unfolding of the wild-type Cel7A (s) and the pH mutant enzyme (h) at (A) pH 5.8 and (B) pH 8.0 Analysis of heat denaturation of the wild-type and mutant protein at pH 5.8 ... 8.0 and 25 °C Spectra of the wild-type Cel7A at pH 5.8 (d) and pH 8.0 (s), and the pH mutant at pH 5.8 (j) and pH 8.0 (h) were recorded from 240 to 190 nm using a 1-mm path length cell and a bandwidth ... proteins In the series of experiments presented here, we study the thermostability of T reesei wild-type Cel7A and a mutant with a more alkaline pH optimum, and focus especially on the alkaline pH area...
  • 8
  • 167
  • 0

making wild wines and meads 1999 - vargas & gulling

making wild wines and meads 1999 - vargas & gulling
... MAKING Wild WINES & MEADS MAKING Wild WINES & MEADS 125 Unusual Recipes Using Herbs, Fruits, Flowers & More PATTIE VARGAS & RICH GULLING The mission of Storey Publishing ... Cataloging-in-Publication Data Vargas, Pattie, 1941– Making wild wines & meads: 125 unusual recipes using herbs, fruits, flowers & more/Pattie Vargas & Rich Gulling p cm Includes index ISBN 97 8-1 -5 801 7-1 8 2-3 ... 97 8-1 -5 801 7-1 8 2-3 (paperback: alk paper) Wine and winemaking Amateurs’ manuals Mead Amateurs’ manuals I Gulling, Rich, 1961– II Title III Title: Making wild wines and meads IV Title: Wild wines & meads...
  • 218
  • 46
  • 0

Báo cáo sinh học: " In vitro permissivity of bovine cells for wild-type and vaccinal myxoma virus strain" pot

Báo cáo sinh học:
... P3 BT MDBK Figure Permissivity of bovine cell lines for myxoma virus Permissivity of bovine cell lines for myxoma virus Bovine cells were maintained in DMEM (KOP-R and BT) or MEM (MDBK) supplemented ... information concerning interactions between MYXV and bovine cells is available yet In this study, we characterized the infection of bovine cell lines and bovine peripheral blood mononuclear cells ... comparing two different MYXV strains (a wild-type strain (T1) and a cell-cultured attenuated vaccinal strain (SG33) [14]) we verified the stability of the viral tropism in vitro Findings Three bovine...
  • 5
  • 160
  • 0

Báo cáo hóa học: " In vitro permissivity of bovine cells for wild-type and vaccinal myxoma virus strains" potx

Báo cáo hóa học:
... P3 BT MDBK Figure Permissivity of bovine cell lines for myxoma virus Permissivity of bovine cell lines for myxoma virus Bovine cells were maintained in DMEM (KOP-R and BT) or MEM (MDBK) supplemented ... information concerning interactions between MYXV and bovine cells is available yet In this study, we characterized the infection of bovine cell lines and bovine peripheral blood mononuclear cells ... comparing two different MYXV strains (a wild-type strain (T1) and a cell-cultured attenuated vaccinal strain (SG33) [14]) we verified the stability of the viral tropism in vitro Findings Three bovine...
  • 5
  • 156
  • 0

Báo cáo khoa học: "Cold storage of in vitro cultures of wild chestnut and oak" pdf

Báo cáo khoa học:
... INTRODUCTION Collections of seeds and clonal material are traditional ways of storing genetic resources Use of cold stored (0-10°C) in vitro cultures is a complementary method of maintaining ... obtained in this work clearly show the possibility of keeping wild cherry, oak and chesnut cultures in cold storage for at least year without subculturing When stored after 10 d of preculture in ... capacity of the cultures was retained In this way, cold storage offers a potential means of reducing costs of micropropagation and affords an alternative method for conserving genetic resources of...
  • 7
  • 81
  • 0

Báo cáo y học: "High resolution transcriptome maps for wild-type and nonsense-mediated decay-defective Caenorhabditis elegans." potx

Báo cáo y học:
... for a complex transcriptome is still costly, and assembly of the data is still computationally intensive Since tiling arrays and sequencing have complementary benefits for transcriptome analysis, ... pathways [8,9] Recently, genome-scale tiling arrays and massively parallel sequence analysis of transcriptomes have emerged as powerful new tools for transcriptome analysis [10-14] Both rely on ... They thus provide an unbiased and rich view of the changing transcriptome across development and our immediate goal was to map the wild-type transcriptome at good coverage and resolution and, ...
  • 18
  • 190
  • 0

Xem thêm

Từ khóa: BẤT ĐẲNG THỨC TÍCH PHÂN THUỘC LOẠI OSTROWSKI CHO HÀM KHẢ VI CẤP HAIBENITO MUSSOLINI VÀ CHỦ NGHĨA PHÁT XÍT ITALIA (1922 - 1943)BIẾN ĐỔI LAPLACE VÀ MỘT SỐ ỨNG DỤNGCÁC BIỆN PHÁP GIÚP HỌC SINH GHI NHỚ TỐT TRONG DẠY HỌC HÓA HỌCBồi dưỡng học sinh giỏi tiếng anh tiểu họcLập trình giao diện với android tài liệuTHỊ TRƯỜNG CHỨNG KHOÁN PHI TẬP TRUNG – OTCPháp luật Việt Nam về cho thuê tài chính theo hình thức hợp đồng bán và thuê lạiPhân tích và đề xuất một số giải pháp nhằm nâng cao hiệu quả kinh doanh của công ty xăng dầu Hà Nam Ninh.đề cương môn sinh học tế bàoBài giảng KẾ TOÁN TÀI SẢN NGẮN HẠNXây dựng chiến lược kinh doanh cho Công ty cổ phần Sản xuất và thương mại Việt ThànhĐiều trị rối loạn lipid máu dựa trên các khuyến cáo hiện nayBài giảng EM TẬP VẼBài Giảng Vẽ Hình Chữ Nhật, Hình VuôngTác phẩm nghệ thuật sẽ chết nếu nó miêu tả cuộc sống chỉ để miêu tả, nếu nó không phải là tiếng thét khổ đau hay lời ca tụng hân hoan, nếu nó không đặt ra những câu hỏi hoặc trả lời những câu hỏi đóNLVHEbook Chăm sóc người nhiễm HIVAIDS (dùng cho đào tạo cử nhân điều dưỡng) Phần 1Ebook Chăm sóc người nhiễm HIVAIDS (dùng cho đào tạo cử nhân điều dưỡng) Phần 2CHINH PHỤC bài tập HOÁ KHÓBài giảng Bệnh mắt Basedow (Hyperthyroid Eye Disease Basedow’s ophthalmopathy)
Nạp tiền Tải lên
Đăng ký
Đăng nhập