62679 its beginning to

Development of the Quantitative PCR Method for Candidatus ‘Accumulibacter phosphatis’ and Its Application to Activated Sludge

Development of the Quantitative PCR Method for Candidatus ‘Accumulibacter phosphatis’ and Its Application to Activated Sludge
... archaebacteria Candidatus ‘Accumulibacter phosphatis’ Candidatus ‘Accumulibacter phosphatis’ Candidatus ‘Accumulibacter phosphatis’ Candidatus ‘Accumulibacter phosphatis’ Candidatus ‘Accumulibacter phosphatis’ ... Quantitative PCR and FISH method in Activated sludge The amount of Candidatus ‘Accumulibacter phosphatis’ in the laboratory-scale and the full-scale activated sludge were quantified both by the quantitative ... abundance in activated sludge Nevertheless, quantitative PCR method for Candidatus ‘Accumulibacter phosphatis’ has not been developed yet In this study, quantitative PCR method for Candidatus ‘Accumulibacter...
  • 7
  • 218
  • 0

Tài liệu Báo cáo khoa học: "Organizing Encyclopedic Knowledge based on the Web and its Application to Question Answering" ppt

Tài liệu Báo cáo khoa học:
... Nichigai dictionary On the other hand, in the case where random choice was performed, the Nichigai dictionary and the Webbased encyclopedia were comparable in terms of both the coverage and accuracy ... Examinations The Class II examination consists of quadruple-choice questions, among which technical term questions can be subdivided into two types In the first type of question, examinees choose the ... the description For the second type of question, human examinees would search their knowledge base for the description of each of four candidate terms Then they would choose the candidate term...
  • 8
  • 96
  • 0

Tài liệu Báo cáo khoa học: "AUTOMATIC SPEECH RECOGNITION AND ITS APPLICATION TO INFORMATION EXTRACTION" pdf

Tài liệu Báo cáo khoa học:
... speech recognition and topicword extraction", Proc IEEE Int Conf Acoust., Speech, Signal Process., Phoenix, pp 625-628 (1999) [6] M Witbrock and A G Hauptmann: "Speech recognition and information ... Since speech is the most natural and efficient communication method between humans, automatic speech recognition will continue to find applications, such as meeting/conference summarization, automatic ... value has lead to rapid technology transfer of speech recognition into other research areas and applications Since the variations in speaking style and accent as well as in channel and environment...
  • 10
  • 131
  • 3

Tài liệu Báo cáo Y học: Importance of the amino-acid composition of the shutter region of plasminogen activator inhibitor-1 for its transitions to latent and substrate forms pdf

Tài liệu Báo cáo Y học: Importance of the amino-acid composition of the shutter region of plasminogen activator inhibitor-1 for its transitions to latent and substrate forms pdf
... Both transitions to latent and substrate forms were strongly but differently influenced by the amino-acid composition of the shutter region Surprisingly, we found that substitution of Lys335 to ... investigate the importance of the shutter region for the unique types of RCL insertion in PAI-1, we have now undertaken a number of substitutions in the shutter region and b strand 5A of PAI-1 and studied ... 8C [37] Therefore, to study the effect of shutter region substitutions on the transition of PAI-1 to a substrate form, we replaced the BSA in the assay buffer with 0.2% Triton X-100 The variants...
  • 10
  • 73
  • 0

The Savings and Loan Crisis and Its Relationship to Banking pptx

The Savings and Loan Crisis and Its Relationship to Banking pptx
... favor in order to keep regulators from interfering in their operations 180 History of the Eighties—Lessons for the Future Chapter The Savings and Loan Crisis and Its Relationship to Banking with ... Future Chapter The Savings and Loan Crisis and Its Relationship to Banking partly to the fact that members of both political parties were vulnerable to criticism for their role in the crisis. 66 It ... collapsed or were abandoned For a discussion of these issues, see Chapter 168 History of the Eighties—Lessons for the Future Chapter The Savings and Loan Crisis and Its Relationship to Banking Table...
  • 22
  • 140
  • 0

Báo cáo khoa học: N-Glycosylation is important for the correct intracellular localization of HFE and its ability to decrease cell surface transferrin binding pptx

Báo cáo khoa học: N-Glycosylation is important for the correct intracellular localization of HFE and its ability to decrease cell surface transferrin binding pptx
... effect of HFE binding to TfR1 is to lower the affinity of the receptor for transferrin [15] This most likely reflects the existence of overlapping HFE and transferrin- binding sites on the receptor ... understanding suggests that the majority of cell types regulate cellular iron levels by binding of transferrin to the type transferrin receptor [15] The crystal structure of HFE complexed to the ... We propose that glycosylation is important for the folding of HFE and is essential for transport and exit of the protein from the ER The importance of glycosylation is cumulative, however, with...
  • 16
  • 165
  • 0

Báo cáo khoa học: Activator-binding domains of the SWI ⁄ SNF chromatin remodeling complex characterized in vitro are required for its recruitment to promoters in vivo pot

Báo cáo khoa học: Activator-binding domains of the SWI ⁄ SNF chromatin remodeling complex characterized in vitro are required for its recruitment to promoters in vivo pot
... activation of these genes within the same time window The activator-binding domains in the Swi1 and Snf5 subunits of the SWI SNF complex are essential for recruitment of the SWI SNF complex to these ... regions of SWI SNF cannot replace the recruiting function of the Swi1 and Snf5 activator-binding domains The in vivo validation of the Swi1 and Snf5 activator-binding domains is also of interest in ... experimental conditions The activator-binding domains of Swi1 and Snf5 are required for promoter recruitment of the SWI SNF complex We next studied the level of SWI SNF recruitment to the GAL1-10, GAL2...
  • 9
  • 138
  • 0

Báo cáo khoa học:The principle of flux minimization and its application to estimate stationary fluxes in metabolic networks docx

Báo cáo khoa học:The principle of flux minimization and its application to estimate stationary fluxes in metabolic networks docx
... case of the more general principle of flux minimization It has to be noted, furthermore, that minimization of fluxes in a metabolic system is closely linked to minimization of enzyme levels, because ... protein, protein interactions, enzymes, metabolites) can be used to build up mathematical models of the gene-regulatory, signal-transducing and metabolic networks of a cell and to integrate them into ... given total flux is obviously equivalent to maintaining a given rate of biomass production at a minimum of the total flux Insofar, the principle of maximal biomass production is a special case of...
  • 18
  • 193
  • 0

Báo cáo khoa học: Characterization of a cathepsin L-associated protein in Artemia and its relationship to the FAS-I family of cell adhesion proteins pot

Báo cáo khoa học: Characterization of a cathepsin L-associated protein in Artemia and its relationship to the FAS-I family of cell adhesion proteins pot
... CLAP_1:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTAAAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT CLAP_2:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTAAAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT ... CLAP_2:ATTAGTGCTATAGTTTGGGAAATATTTAGTCCTTGTTTTGTGTGATCTTATAAGATAATATTTGTAGTTTGTGCTTTTATATAATTTAGCTCATTGGATT 1730 * 1888 CLAP_1:AAGATCTTCTGAATGTGATTATATGCGGCTGTGTTTTCTAATAGATTTCTAGATACGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA CLAP_2:AAGATCTTCTGAATGTGATTATATGCGGCTGTGTTTTCTAATAGATTTCTAGATACGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA (A) 48 ... CLAP_1:AAGTCTGTCGTCAAAATGTTATGAACGTCTCTTGTCATAAAGAAAGATAACCTCTCTTTTTAGTTTGGTTTAGATATTAAGGACAGATCCAAAATATTTG CLAP_2:AAGTCTGTCGTCAAAATGTTATGAACGTCTCTTGTCATAAAGAAAGAGAACCTCTCTTTTTAGTTTGGTTTAGATATTAAGGACAGATCCAAAATATTTG * CLAP_1:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTAAAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT...
  • 12
  • 189
  • 0

Báo cáo khoa học: "Bayesian Synchronous Tree-Substitution Grammar Induction and its Application to Sentence Compression" pdf

Báo cáo khoa học:
... of rule c → e, and K is the total number of ways to rewrite c, we now take into account our DP(αc , P0 (· | c)) prior in (1), which, when truncated to a finite grammar, reduces to a K-dimensional ... prior and selects a compact representation of the data (grammar sizes ranged from 4K-7K for GS compared to a grammar of about 35K rules for EM) (2) GS does not commit to a precomputed grammar and ... 2009; Post and Gildea, 2009) and machine translation (DeNero et al., 2008; Cohn and Blunsom, 2009; Liu and Gildea, 2009) Segmentation is achieved by introducing a prior bias towards grammars that...
  • 11
  • 132
  • 0

Báo cáo khoa học: "A Method for Relating Multiple Newspaper Articles by Using Graphs, and Its Application to Webcasting" pptx

Báo cáo khoa học:
... words for the articles These words show new information in the article, and make it easy to understand t h e content of the articles If a word in an article appears in the differentia words for its ... the story of the articles For example, the word "state" is the differentia word for dT, and is in its adjacent articles ds, dg, anddlo This means that d7 is a starting point of the new topic ... existence of a topic In V, for a particular topic, the in-degrees of related nodes {dT, ds, dg, dl0} is a cycle for the topic "statement." increase, since these articles are connected to each By recognizing...
  • 7
  • 113
  • 0

Báo cáo khoa học: "Generalized Encoding of Description Spaces and its Application to Typed Feature Structures" potx

Báo cáo khoa học:
... bound of the types of the frames being unified, (2) update one frame's type to the least upper bound, and point the other's type representation to it, and (3) recurse on respective pairs of feature ... variables to various substructures of a TFS, , and then pass those variables outside the substructures of where they can be used to instantiate the value of another feature structure's feature, ... properties of fixed-arity terms when it comes to unification, due to appropriateness Nevertheless, unbounded subtyping chains and acquiring new features conspire to force most internal representations of...
  • 8
  • 142
  • 0

Women’s Employment and Its Relation to Children’s Health and Schooling in Developing Countries: Conceptual Links, Empirical Evidence, and Policies pptx

Women’s Employment and Its Relation to Children’s Health and Schooling in Developing Countries: Conceptual Links, Empirical Evidence, and Policies pptx
... how global trends toward urbanization and international economic integration are affecting women’s work in developing countries and its relation to children’s health and schooling The section also ... complex relationships of women’s work to children’s health and schooling. 2 Before reviewing existing empirical work I outline, in the next section, the conceptual frameworks delineating the pathways ... trends in developing economies and in the global economy that are affecting women’s work and its relation to children’s welfare, as well as affecting the ability of governments to intervene to ease...
  • 52
  • 124
  • 0

Panorama: A Database System that Annotates Its Answers to Queries with their Properties potx

Panorama: A Database System that Annotates Its Answers to Queries with their Properties potx
... SYSTEM THAT ANNOTATES ITS ANSWERS 63 In addition, Panorama extends the query language with three statements to manipulate and query the meta -database To add a new property view to the meta -database, ... detector, a, b2 )} V4 is represented with two meta-tuples: (E, x3 ∗, Virginia, ) ∈ store (E, radar detector, x3 ∗, ) ∈ availability PANORAMA: A DATABASE SYSTEM THAT ANNOTATES ITS ANSWERS 3.3 59 Manipulation ... particular, each x and each y must appear at least once among the zs PANORAMA: A DATABASE SYSTEM THAT ANNOTATES ITS ANSWERS D E D Q Q c A 57 Ec A Figure Meta-processing We refer to such views as conjunctive...
  • 23
  • 125
  • 0

Xem thêm

Từ khóa: IUH PHI NUOC THAI DH CONG NGHIEP TP HO CHI MINHIUH PHONG CHONG THAM NHUNG DH CONG NGHIEP TP HO CHI MINHHoàn thiện kế toán chi phí với việc tăng cường quản trị chi phí các doanh nghiệp chế biến thức ăn chăn nuôi.PDFHoàn thiện kế toán chi phí, doanh thu và kết quả kinh doanh dịch vụ viễn thông tại các đơn vị thuộc công ty thông tin viễn thông Điện lựcIUH CHAT LUONG SP DH CONG NGHIEP TP HO CHI MINHIUH TUAN HOAN VA CHU CHUYEN TB DOI VOI VIEC SU DUNG NGUON VON TRONG NUOC DH CONG NGHIEP TP HO CHI MINHHoàn thiện kế toán chi phí, doanh thu và kết quả kinh doanh tại các doanh nghiệp phân phối Giấy tiêu dùng trên địa bàn Hà nộiIUH CHAT LUONG SAN PHAM DH CONG NGHIEP TP HO CHI MINHIUH LY THUYET TUAN HOAN VA CHU CHUYEN TB DH CONG NGHIEP TP HO CHI MINHIUH HT KENH PHAN PHOI GAS TREN TT MIEN BAC CUA CTY BP PETCO LTD DH CONG NGHIEP TP HO CHI MINHIUH DAO TAO NGHE VOI VIEC CHUYEN DICH CO CAU LD TAI VN DH CONG NGHIEP TP HO CHI MINHHoàn thiện kế toán doanh thu chi phí và kết quả sản xuất kinh doanh tại công ty thông tin viễn thông Điện lựcHoàn thiện kế toán hàng tồn kho tại các doanh nghiệp thương mại thuộc địa bàn Tỉnh Sơn LaIUH CAU LD TRONG CHUYEN DICH KT VN HIEN NAY DH CONG NGHIEP TP HO CHI MINHQuản trị kinh doanh luôn là một trong những ngànhIUH XNK UY THAC DH CONG NGHIEP TP HO CHI MINHIUH TT THUY SAN DH CONG NGHIEP TP HO CHI MINHIUH HOAT DONG MAR TRONG LINH VUC NGAN HANG TAI VN DH CONG NGHIEP TP HO CHI MINHIUH LAM PHAT VA GIAI PHAP DH CONG NGHIEP TP HO CHI MINHIUH XK TOM DH CONG NGHIEP TP HO CHI MINH
Nạp tiền Tải lên
Đăng ký
Đăng nhập