8382 the belly and the members

Tài liệu Báo cáo khoa học: Regulation of the members of the mammalian heat shock factor family doc

Tài liệu Báo cáo khoa học: Regulation of the members of the mammalian heat shock factor family doc
... (2001) Roles of ¨ the heat shock transcription factors in regulation of the heat shock response and beyond FASEB J 15, 1118–1131 Fujimoto M & Nakai A (2010) The heat shock factor family and adaptation ... In accordance with the fundamental role of HSF1 in the heat shock response, the requirement of HSF1 and HSF4 in development of the lens and olfactory epithelium is limited to the postnatal period, ... by the recent findings that different members of the HSF family are able to interact, both structurally and functionally, thereby impacting the actions of their partners The interplay among the...
  • 14
  • 188
  • 0

Tài liệu Class, Structure, and Interface Members docx

Tài liệu Class, Structure, and Interface Members docx
... constructor for the SqlCommand class is: public SqlCommand( ); In VB, the constructor is represented by a call to a class's New subprocedure The equivalent call to the SqlCommand class constructor ... Sub New( ) A.5.3 Properties The SqlCommand.CommandText property provides a typical example of a property definition using C# syntax: public string CommandText {get; set;} Like all C# type definitions, ... number of object-oriented qualifiers with methods These, and their VB equivalents, are shown in Table A-4 Table A-4 C# keywords used with methods and their VB equivalents C# keyword VB keyword abstract...
  • 5
  • 177
  • 0

Tài liệu Báo cáo khoa học: Structural and functional specificities of PDGF-C and PDGF-D, the novel members of the platelet-derived growth factors family docx

Tài liệu Báo cáo khoa học: Structural and functional specificities of PDGF-C and PDGF-D, the novel members of the platelet-derived growth factors family docx
... PDGF-C and -D, structure and function L J Reigstad et al endothelial growth factors (VEGF) and the family is therefore often referred to as the PDGF ⁄ VEGF family The PDGF family of growth factors ... however further understanding of how these factors interplay with other members of the cystine knot family and in particular the PDGF-A, -B, and VEGF growth factors, must be the focus of future ... PDGF-D, resulting in perivascular lymphoid cell infiltrates of the lung and fibrosis in the liver [110] Conclusions The novel members, PDGF-C and -D, of the PDGF subfamily of the cystine knot family...
  • 19
  • 154
  • 0

Báo cáo khoa học: The Vps4 C-terminal helix is a critical determinant for assembly and ATPase activity and has elements conserved in other members of the meiotic clade of AAA ATPases pdf

Báo cáo khoa học: The Vps4 C-terminal helix is a critical determinant for assembly and ATPase activity and has elements conserved in other members of the meiotic clade of AAA ATPases pdf
... TGGACGGATATTGAAGCTGATCTCACCATAAAGGAT ATCCTTTATGGTGAGATCAGCTTCAATATCCGTCCA TTAAAGGCTATCAAATCGCAAGAACAGTTCACTAGA TCTAGTGAACTGTTCTTGCGATTTGATAGCCTTTAA GAAGCAAGAACAGTTCACTTAGTCAATTGATTAACGTG CACGTTAATCAATTGACTAAGTGAACTGTTCTTGCTTC ... be other meiotic clade AAA ATPases and have the AAA domain helix and the C-terminal helix, but not the b domain The distinguishing feature of members of the meiotic clade of AAA ATPases is the ... Role of the Vps4 C-terminal helix Fig 11 A C-terminal helix is a characteristic feature of meiotic clade AAA ATPases Sequence alignments of some of the proteins listed in the PFAM database that...
  • 23
  • 194
  • 0

Báo cáo khoa học: Relation between domain evolution, specificity, and taxonomy of the a-amylase family members containing a C-terminal starch-binding domain pot

Báo cáo khoa học: Relation between domain evolution, specificity, and taxonomy of the a-amylase family members containing a C-terminal starch-binding domain pot
... involve also the cluster of acarviose transferase (Actsp), archaeal CGTase (Thcsp) and the maltogenic a- amylase (Bacst) due to its longer branch separating it from the Ó FEBS 2003 a- Amylase family members ... branches adjacent to each other and close to the border that separates the two major parts of the tree Note that the B stearothermophilus maltogenic a- amylase (Bacst) is placed in the ÔCGTase ... based on the alignments of the individual domains A, B, C and E (i.e the SBD) A tree was not constructed on the D domain because, as mentioned above, the fourdomain amylases and the two CGTases...
  • 11
  • 199
  • 0

SAVINGS BANKS'''' SOCIALLY RESPONSIBLE ACTIVITIES, A WEALTH OF EXPERIENCE: INSIGHTS FROM WSBI MEMBERS IN AFRICA, ASIA AND THE AMERICAS pot

SAVINGS BANKS'''' SOCIALLY RESPONSIBLE ACTIVITIES, A WEALTH OF EXPERIENCE: INSIGHTS FROM WSBI MEMBERS IN AFRICA, ASIA AND THE AMERICAS pot
... retail banks and associations thereof in 86 countries of the world (Asia- Pacific, the Americas, Africa and Europe – via the European Savings Banks Group) At the start of 2005, assets of member banks ... ensure the participation of Brazilian Athletics Teams in more than 30 national and international competitions and in 15 other Caixa events that are part of the National Calendar of Sports Caixa also ... JapanPost - Special time savings  Case Study 3: National Savings Bank in Sri Lanka - Gaurawa deposit scheme  Case Study 4: Caixa Economica Federal of Brazil - Turning income into savings and...
  • 32
  • 126
  • 0

An experimental analysis of the factors impacting audit committee members' judgments and decisions

An experimental analysis of the factors impacting audit committee members' judgments and decisions
... Groff, and my committee members, Dorothy Flannagan, Elaine Sanders and Pamela Smith without whom this would not have been possible AN EXPERIMENTAL ANALYSIS OF THE FACTORS IMPACTING AUDIT COMMITTEE ... experience of the audit committee financial expert Almost half of the financial experts of the large firms sampled have held the positions of Chief Executive Officer and/ or Chairman of the Board of other ... corporate financial factors, the position of the external auditor and the level of independence and knowledge of the audit committee member The results of these studies would seem to suggest that the...
  • 95
  • 186
  • 0

Báo cáo khoa học: " AT-101, a small molecule inhibitor of anti-apoptotic Bcl-2 family members, activates the SAPK/JNK pathway and enhances radiation-induced apoptosis" pdf

Báo cáo khoa học:
... survival after radiation A Gossypol and radiation activate the SAPK/JNK pathway Because SAPK/JNK- mediated signaling plays an important role in radiation-, chemotherapy- and environmental stress-induced ... data RR carried out part of the apoptosis assays and provided supplementary results MV conceived and designed the experiments, analyzed data and wrote the paper All authors read and approved the ... p-SAPK SAPK 15 60 120 240 p-SAPK UM-SCC-11B SAPK p-SAPK U937 C AT RT 15 30 60 120 240 360 RT+AT Figure Gossypol and radiation activate the SAPK/JNK pathway Gossypol and radiation activate the SAPK/JNK...
  • 10
  • 57
  • 0

Báo cáo y học: "Practices of entomophagy and entomotherapy by members of the Nyishi and Galo tribes, two ethnic groups of the state of Arunachal Pradesh (North-East India)" potx

Báo cáo y học:
... Ethnobotany New York, Freeman Publ; 1996, 1-228 doi:10.1186/1746-4269-7-5 Cite this article as: Chakravorty et al.: Practices of entomophagy and entomotherapy by members of the Nyishi and Galo tribes, ... one of the favourite insect food items of the Galo, but not the Nyshi people Some of the pentatomid and pyrrhocorid bugs are rejected from the list of edible insects by the Galo, as the Galo ... number of species consumed by the Nyishi Bangni of the East Kameng district is higher than that of the Galo of the West Siang district In the West Siang district mostly Orthoptera followed by Hymenoptera...
  • 14
  • 203
  • 0

Báo cáo y học: "Vertebrates used for medicinal purposes by members of the Nyishi and Galo tribes in Arunachal Pradesh (North-East India)" pdf

Báo cáo y học:
... paralysis by the Ao Naga [49] and with leucoderma by the tribes of Kerala [60] The Mompa of Arunachal use the fat of the crow in cases of smallpox and malaria [27] Members of the Nyishi and Galo tribes ... is used for enhancing body immunity and resistance to malaria by the Koya and Lambada tribes of Andhra Pradesh, the Ao Naga of Nagaland, and the Mompa of Arunachal Pradesh [27,59] Amongst the tribes ... Table Inventory of vertebrate species used for medicinal purposes by members of Nyishi (N) and Galo (G) tribes in Arunachal Pradesh (N E India) (Continued) 10 Monitor lizard Horkek(G) Baminsopin...
  • 14
  • 183
  • 0

báo cáo khoa học: " Validity and usefulness of members reports of implementation progress in a quality improvement initiative: findings from the Team Check-up Tool (TCT)" pot

báo cáo khoa học:
... and implementation of the analytic plan and data interpretation, and drafted the manuscript YJH acquired the data, performed all statistical analysis, and participated in data interpretation and ... were retained in the analysis Details regarding randomization and other aspects of the parent study are provided elsewhere [13] Primary measures The Team Check-up Tool (TCT) is an original instrument ... leadership and organizational support can vary across teams and, notably, change over the course of an intervention [6] Monitoring implementation context can help teams and QI collaborative faculty and...
  • 13
  • 78
  • 0

The role of paxillin superfamily members hic 5 and leupaxin in b cell antigen receptor signaling 1

The role of paxillin superfamily members  hic 5 and leupaxin in b cell antigen receptor signaling 1
... membrane fraction 45 < /b> 46 47 47 50< /b> 50< /b> 51 52< /b> 53< /b> 54< /b> 55< /b> 55< /b> 56< /b> 56< /b> 57< /b> 58< /b> 58< /b> 59< /b> 59< /b> 59< /b> 60 61 62 62 62 62 63 63 64 65 < /b> 65 < /b> 66 67 68 CHAPTER 3: THE < /b> ROLE < /b> OF < /b> HIC-< /b> 5 < /b> IN < /b> B CELL RECEPTOR SIGNALING 3 .1 Introduction 3.2 ... Ligases 1. 6.4 .1 C-Cbl 1. 6.4.2 Cbl -b Paxillin < /b> superfamily < /b> members < /b> 1. 7 .1 Paxillin < /b> 1. 7.2 Hic-< /b> 5 < /b> 1. 7.3 Leupaxin < /b> Rationale and < /b> aims of < /b> this project 1 10 12 13 17 20 23 26 26 26 28 29 29 31 32 32 33 35 < /b> 35 < /b> ... 3 .5 < /b> 3.2.4 Interaction of < /b> Bam32 homologues: TAPP1 and < /b> TAPP2, with Hic-< /b> 5 < /b> and < /b> paxillin < /b> 75 < /b> 3.2 .5 < /b> PH domain of < /b> Bam32 mediates binding to Hic-< /b> 5 < /b> and < /b> paxillin < /b> 78 3.2.6 Interaction of < /b> Hic-< /b> 5 < /b> and < /b> paxillin...
  • 191
  • 200
  • 0

The role of paxillin superfamily members hic 5 and leupaxin in b cell antigen receptor signaling 2

The role of paxillin superfamily members  hic 5 and leupaxin in b cell antigen receptor signaling 2
... Thus, leupaxin < /b> plays an inhibitory role < /b> in < /b> BCR signaling and < /b> B cell function Inhibitory Role < /b> of < /b> Leupaxin < /b> in < /b> BCR Signaling RESULTS Leupaxin < /b> Is Activated upon BCR Engagement in < /b> Human BJAB B Cells—It ... duction of < /b> IL -2 by activated B cells Inhibitory Role < /b> of < /b> Leupaxin < /b> in < /b> BCR Signaling Tyrosine 72 of < /b> Leupaxin < /b> Is Important for Its Inhibitory Function—As shown above (Fig 4B) , Tyr 72 of < /b> LPXN was the < /b> ... Inhibitory Role < /b> of < /b> Leupaxin < /b> in < /b> BCR Signaling 27 184 JOURNAL OF < /b> BIOLOGICAL CHEMISTRY peak between and < /b> 15 < /b> after BCR ligation in < /b> BJAB cells The < /b> binding of < /b> LPXN to Lyn appeared to occur in < /b> response to BCR...
  • 11
  • 152
  • 0

Xem thêm

Từ khóa: Nghiên cứu điều trị tuỷ răng hàm lớn thứ nhất, thứ hai hàm dưới có sử dụng trâm protaper và máy x smartThực trạng bệnh quanh răng và các yếu tố liên quan ở người cao tuổi tại thành phố hà nộiThực trạng và một số yếu tố liên quan đến tổn thương đốm trắng quanh mắc cài trong điều trị nắn chỉnh răngQUẢN lý HOẠT ĐỘNG ĐÁNH GIÁ kết QUẢ học tập của SINH VIÊN TRƯỜNG CAO ĐẲNG kỹ THUẬT CÔNG NGHIỆPTăng cường thu hút và sử dụng vốn FDI tại tỉnh Hưng YênQUẢN lý TRƯỜNG TIỂU học THEO TIẾP cận QUẢN lý dựa vào NHÀ TRƯỜNGĐÀO tạo NGHỀ CHO LAO ĐỘNG NÔNG THÔN HUYỆN PHÚC THỌ, THÀNH PHỐ hà nộiNGHIÊN cứu KHẢ NĂNG SINH TRƯỞNG, một số đặc điểm GIẢI PHẪU, SINH lí của LOÀI vẹt HAIESII (bruguiera hainesii rog ) và vẹt dù (bruguiera gymnorrhiza (lour ) poir ) TRỒNG THÍ NGHIỆM tại xã GIAO lạc, HUYỆN GIAO THUỶ, TỈNH NAM ĐỊNHNghiên cứu chỉ số non – HDL cholesterol ở bệnh nhân đái tháo đường cao tuổi có yếu tố nguy cơ tim mạchNghiên cứu áp dụng bảng điểm okuda, CLIP, barcelona trong phân loại bệnh nhân ung thư biểu mô tế bào ganMô tả đặc điểm lâm sàng, cận lâm sàng và nguyên nhân gây hồng ban nút tại khoa cơ xương khớp – bệnh viện bạch maiMÔ HÌNH vũ TRỤ CHUẨN LAMBDA CDMNGHIÊN cứu HIỆU QUẢ bảo vệ cơ TIM của SEVOFLURAN TRONG PHẪU THUẬT THAY VAN ĐỘNG MẠCH CHỦHÌNH TƯỢNG NGƯỜI ANH HÙNG CHỐNG NGOẠI xâm QUA NHÓM TRUYỀN THUYẾT CHI LĂNG, LẠNG sơnNĂNG lực TIẾNG VIỆT của học SINH TRƯỜNG THCS NÙNG NÀNG và TRƯỜNG nội TRÚ HUYỆN TAM ĐƯỜNG TỈNH LAI CHÂUNHÓM TÍNH từ CHỈ đặc điểm về LƯỢNG của sự vật đặc điểm NGỮ NGHĨA và kết TRỊVẤN đề địa lý – LỊCH sử TRONG tác PHẨM GIA ĐỊNH THÀNH THÔNG CHÍ và sử học bị KHẢOTỔ CHỨCDẠY học CHỦ đề TÍCH hợp “DÒNG điện KHÔNG đổi TRONG CUỘC SỐNG” ở TRUNG học PHỔ THÔNGCambridge practice tests for IELTS 6NGũ GIớI, THậP THIệN TRONG đạo PHậT và ý NGHĩA của nó đối với GIáO dục đạo đức CHO THANH NIÊN VIệT NAM HIệN NAY