58742 prompts for a speaking activity 3 (1)

An investigation into students’ conversational needs and some suggestions for a speaking syllabus to the 2nd year english bachel

An investigation into students’ conversational needs and some suggestions for a speaking syllabus to the 2nd year english bachel
... designing a syllabus are illustrated as follows Needs analysis-Objectives and aims-Sequencing–Teaching method–Testing and evaluation As a result, analyzing the needs of learners is the first and the foremost ... able to learn the foreign language as a means for close communication and acceptance by people who speak it Learners with instrumental motivation may learn a foreign language for an intermediate ... official and fixed syllabus; on the other hand, the current syllabus seems not satisfied with the students’ conversational needs Thus, analyzing the students’ needs to design an appropriate speaking...
  • 43
  • 178
  • 1

Tài liệu Activity 3.1: Identifying Data-Related Use Cases and Data Requirements docx

Tài liệu Activity 3.1: Identifying Data-Related Use Cases and Data Requirements docx
... 8 Activity 3.1: Identifying Data- Related Use Cases and Data Requirements Exercise 1: Identifying Use Cases that Require Data In this exercise, you will identify data requirements from ... corrects data errors Managerial data Managers print invoices Final time and billing information Activity 3.1: Identifying Data- Related Use Cases and Data Requirements Exercise 2: Identifying Hidden Data ... Managerial data Forecasting data To predict future trends Profitability information To determine future directions and courses of actions 10 Activity 3.1: Identifying Data- Related Use Cases and Data Requirements...
  • 4
  • 161
  • 0

Tài liệu Activity 3.1: Identifying Categories of Information ppt

Tài liệu Activity 3.1: Identifying Categories of Information ppt
... 16 Activity 3.1: Identifying Categories of Information Exercise 1: Identifying Categories ! Write down the examples of information in your category Participate ... assigned by the instructor Review the description of the category assigned by the instructor to the group Review the case study and analyze it to find the information related to the category In the...
  • 2
  • 112
  • 0

Green Energy and Technology - Energy for a Warming World Part 1 ppsx

Green Energy and Technology - Energy for a Warming World Part 1 ppsx
... Engineering and Physical Science Edinburgh EH14 4AS United Kingdom a. j.sangster@hw.ac.uk ISSN 18 6 5-3 529 e-ISSN 18 6 5-3 537 ISBN 97 8 -1 -8 488 2-8 3 3-9 e-ISBN 97 8 -1 -8 488 2-8 3 4-6 DOI 10 .10 07/97 8 -1 -8 488 2-8 3 4-6 Springer ... was apparently the hottest in Europe since 15 00, but it was also a year of severe hurricanes Causal connections between climate change, particularly global warming, and hurricanes have been a ... Green Energy and Technology Alan J Sangster Energy for a Warming World A Plan to Hasten the Demise of Fossil Fuels 12 3 Alan J Sangster, PhD, CEng, FIET Heriot-Watt University School...
  • 19
  • 152
  • 0

Báo cáo y học: " CD45 immunoaffinity depletion of vesicles from Jurkat T cells demonstrates that exosomes contain CD45: no evidence for a distinct exosome/HIV-1 budding pathway" doc

Báo cáo y học:
... has not been observed It is important to note that, absolute biochemical purity of virion preparations may not be practically attainable and analyses should be evaluated with this important caveat ... a distinct class of vesicle that not contain CD45, then immunoaffinity depletion would not be able to remove vesicles from virus preparations isolated from cells that reputedly produce mostly ... samples had somewhat less intense staining CA bands than the untreated material Similarly, the bead fractions had CA signal, though at a lower intensity than either the treated or untreated samples,...
  • 5
  • 85
  • 0

Tài liệu Báo cáo khoa học: Characterization of promoter 3 of the human thromboxane A2 receptor gene A functional AP-1 and octamer motif are required for basal promoter activity docx

Tài liệu Báo cáo khoa học: Characterization of promoter 3 of the human thromboxane A2 receptor gene A functional AP-1 and octamer motif are required for basal promoter activity docx
... Prm3 was performed using the mutator primers Kin175 (5¢-CACCAGAGCTACTTACA CTGAATTCCAGAATAATCACAAGCAAATC -3 ; sense primer) vs its complement generating pGL3b:Prm3aOCT)1*, pGL3b:Prm3abOCT)1* and ... Prm3aaAP)1*, pGL3e:Prm3aaAP)1*, pGL3b:Prm3aaaAP)1* and pGL3e:Prm3aaaAP)1* Mutation of the Oct-1 element with the sequence aaA TGCa to aaTTCCa (core bases shown in uppercase letters) centered at )1 23 within ... Prm3aab; pGL3b:Prm3aab & pGL3e:Prm3aab (Primer Kin160; 5¢-dGAGAGGTACCGCAAATCTTCTCTCGCC TCC -3 , corresponding to NTs )106 to )86) (8) Prm3aaa; pGL3b:Prm3aaa & pGL3e:Prm3aaa (Primer Kin161, 5¢-dGAGAGGTACCGCAGCATCGGCCTGATG...
  • 18
  • 187
  • 0


... Online Communities: a new opportunity - Key factors for a successful online community - page Organizational and environmental factors Key factors for a successful online community ORGANIZATIONAL AND ... Culture Online Communities: a new opportunity - Key factors for a successful online community - page Social and cultural factors Defined membership is a way of creating boundaries around an online ... water line!” In this lesson you will explore these factors, starting with social and cultural Online Communities: a new opportunity - Key factors for a successful online community - page Social...
  • 12
  • 136
  • 0

Báo cáo Y học: ik3-1/Cables is a substrate for cyclin-dependent kinase 3 (cdk 3) pdf

Báo cáo Y học: ik3-1/Cables is a substrate for cyclin-dependent kinase 3 (cdk 3) pdf
... residue is also phosphorylated by both cdk3/cyclin A and cdk3/E in vivo (Fig 5) Analysis of ik3-1 amino-acid sequence indicates that ik3-1 has a putative ZRXL (Z and X are typically basic) motif that ... previously [11] To replace Ser274 in ik3-1 cDNA with Thr or Ala, mutagenic primers, 50 -TCTCCGGAGATGTCGAACACT CTCAGGTACTCCCAGACCA -30 or 50 -TCTCCGGAGAT GTCGAACACTCTCAGGTGCTCCCAGACCA -30 (corresponding ... that cyclin/ cdk3 actually phosphorylates ik3-1 P70ik3-1 is phosphorylated by either cyclin A/ cdk3 or cyclin E/cdk3 in vivo Furthermore, to examine whether p70ik3-1 is also phosphorylated by...
  • 7
  • 151
  • 0

Báo cáo khoa học: "SemiWhole brain radiotherapy with a conformational external beam radiation boost for lung cancer patients with 1-3 brain metastasis: a multi institutional study" pdf

Báo cáo khoa học:
... presented with extra cranial failure/local brain failure/distant brain failure and extra cranial failure/distant brain failure, respectively Extra cranial failure and local brain failure only was observed ... metastases patients treated with accelerated-fractionation vs accelerated-hyperfractionated radiotherapy: an analysis from Radiation Therapy Oncology Group Study 91-04 International journal of radiation ... Y: Radiotherapy of brain metastases from carcinoma of the bronchus Clinical radiology 1989, 40:193-194 Page of 15 Egawa S, Tukiyama I, Akine Y, Kajiura Y, Yanagawa S, Watai K, Nomura K: Radiotherapy...
  • 8
  • 193
  • 0

PRAISE vocal training for a dynamic speaking voice workbook 1

PRAISE vocal training for a dynamic speaking voice workbook 1
... an unusually strong burst of hhhhhaaaaataaaataaaaataaaaataaaa air is required - as when special emphasis or loudness is desired - the abdominal muscles hhhhhaaaaadaaaaadaaaaadaaaadaaaaa can act ... in a normal speech pattern Notice a sense of ease when speaking after intoning 1/ 2/ 3/ 4/ 5/ 6/ 7/ 8/ 9/ 10 / 10 11 / 10 11 12 / 10 11 12 13 / 10 11 12 13 14 / 10 11 12 13 14 15 / 10 11 12 13 14 / 10 ... ~ yeee aaah ~ haaa 2.haaa yeee aaah ~ yeee aaah ~ yeee aaah ~ haaa Do as many as you can as fast as you can with out tensing the jaw or tongue and ensuring each vowel sound is clear www.voicepower.ca...
  • 30
  • 97
  • 0

3 Examples Example 1, Single-Cavity Injection Mold for a Polyethylene Cover

3 Examples Example 1, Single-Cavity Injection Mold for a Polyethylene Cover
... pipe; 33 : ball catch; 34 : punch; 35 : cooling pipe; 36 : locating pin; 37 : bushing; 38 : screw; 39 : pillar; 40: support rail Company illustration: Plastor p .A. , Oradea/Romania Example : Injection Mold ... mold cavities formed in the mold insert plates (12, 13) are arranged in the parting plane in such a way that each of two mutually parallel cores of a pair of cavities can be actuated by a common ... 12, p 1227-1 23 Example 9, Injection Mold for Magnifying Glass Frame with Handle Examples of injection moldings with inner peripheral grooves are frames for spectacles and magnifying glasses (Fig...
  • 26
  • 60
  • 1

Xem thêm

Nạp tiền Tải lên
Đăng ký
Đăng nhập