Dengue

Sốt xuất huyết Dengue.pdf

Sốt xuất huyết Dengue.pdf
... sốt xuất huyết Dengue 4.1 Các tiêu chuẩn lâm sàng 4.1.1 Sốt Đột ngột, cao, liên tục - ngày 4.1.2 Biểu xuất huyết Có dấu dây thắt (+) số biểu xuất huyết chấm xuất huyết, đốm xuất huyết, mảng xuất ... Phân loại Sốt xuất huyết Dengue theo mức độ nặng, nhẹ Chia làm độ : 5.1 Độ Sốt kèm với dấu tổng quát không đặc thù Biểu xuất huyết dấu dây thắt (+) 5.2 Độ Có biểu độ kèm với, Xuất huyết tự nhiên, ... chẩn đoán Sốt xuất huyết Dengue, cần có tiêu chuẩn lâm sàng (sốt + xuất huyết) với tiêu chuẩn xét nghiệm (giảm tiểu cầu tăng Hct) đủ Các tuyến y tế sở nên áp dụng phân loại IMCI vấn đề sốt trẻ...
  • 4
  • 1,662
  • 11

Sốt xuất huyết Dengue

Sốt xuất huyết Dengue
... sốt xuất huyết Dengue 4.1 Các tiêu chuẩn lâm sàng 4.1.1 Sốt Đột ngột, cao, liên tục - ngày 4.1.2 Biểu xuất huyết Có dấu dây thắt (+) số biểu xuất huyết chấm xuất huyết, đốm xuất huyết, mảng xuất ... Phân loại Sốt xuất huyết Dengue theo mức độ nặng, nhẹ Chia làm độ : 5.1 Độ Sốt kèm với dấu tổng quát không đặc thù Biểu xuất huyết dấu dây thắt (+) 5.2 Độ Có biểu độ kèm với, Xuất huyết tự nhiên, ... Nguyễn trọng Lân - cấp cứu nhi khoa - chương trình sốt xuất huyết (1993) Bộ Y Tế - Quy định hướng dẫn chẩn đoán, điều trị sốt Dengue sốt xuất huyết Dengue. (2001) ...
  • 4
  • 534
  • 4

Sốt Dengue và sốt xuất huyết Degue

Sốt Dengue và sốt xuất huyết Degue
... nên nặng từ ngày sau - Xuất huyết: Xuất huyết nhẹ: Nghiệm pháp dây thắt dương tính, ngày đầu • Xuất huyết vừa: Có đốm xuất huyết, ban xuất huyết vết bầm xuất huyết Xuất huyết nặng: Chảy máu ... trị sốc sốt xuất huyết Dengue - Nuôi dưỡng bệnh nhân sốt Dengue sốt xuất huyết Dengue 11 Tiêu chuẩn cho người bệnh xuất viện Bao gồm tiêu chuẩn sau: - Hết sốt ngày, tỉnh táo - Mạch, huyết áp ... cầu giảm Sốt xuất huyết Dengue Biệu lâm sàng thường gặp trẻ em người trẻ Khởi đầu tương tự sốt dengue - Sốt: Bệnh nhân sốt đột ngột, sốt cao liên tục, từ đến ngày, ý vào ngày thứ hết sốt, chuyển...
  • 13
  • 378
  • 4

Hiệu quả của một chương trình giáo dục sức khỏe về phòng chống sốt xuất huyết dengue cho học sinh trung học cơ sở tỉnh bình dương

Hiệu quả của một chương trình giáo dục sức khỏe về phòng chống sốt xuất huyết dengue cho học sinh trung học cơ sở tỉnh bình dương
... xác hiệu lực biện pháp can thiệp Sự gia tăng tỉ lệ học sinh có kiến thức, thái độ, thực hành phòng chống bệnh SXHD sau giáo dục sức khỏe cho thấy nội dung chương trình giáo dục sức khỏe hiệu ... Nội dung phương pháp chương trình giáo dục sức khỏe hiệu dù chưa đánh giá dài hạn Từ khoá: sốt xuất huyết dengue, kiến thức thái độ thực hành, giáo dục sức khoẻ, học sinh cấp ABSTRACT EFFECTIVENESS ... chung thị xã Thủ Dầu Một Kiến thức học sinh trước sau giáo dục sức khỏe Trước giáo dục sức khỏe, trừ kiến thức trung gian truyền bệnh muỗi vằn, học sinh có kiến thức đặc tính sinh hoạt muỗi biểu...
  • 23
  • 2,072
  • 1

Giáo trình Dengue xuất huyết

Giáo trình Dengue xuất huyết
... hợp xuất huyết có dấu hiệu dây thắt dương tính • Các biểu xuất huyết tự nhiên xuất huyết tiêm chích thấy bầm tím quanh nơi tiêm • Xuất huyết da: biểu chấm xuất huyết, vết bầm tím, rõ xuất huyết ... tiêu hóa: nôn máu, đại tiện máu Khi có xuất huyết tiêu hóa nhiều, bệnh thường diễn biến nặng Sốt xuất huyết Dengue có sốc: • Khi bị bệnh sốt xuất huyết Dengue cần theo dõi sốc biến chứng nặng ... giảm natri máu xuất đông máu nội quản rải rác gây xuất huyết trầm trọng tiêu hóa quan khác Bệnh nhân xuất huyết não đưa đến hôn mê Tiến triển • Thời kỳ hồi phục sốt xuất huyết Dengue có sốc không...
  • 13
  • 327
  • 1

Chẩn đoán, điều trị sốt Dengue

Chẩn đoán, điều trị sốt Dengue
... DẪN CHẨN ĐOÁN VÀ ĐIỀU TRỊ SỐT DENGUE VÀ SỐT XUẤT HUYẾT DENGUE (Ban hành kèm theo Quyết định số 1536 /2004/QĐ-BYT ngày 29 tháng năm 2004 Bộ trưởng Bộ Y tế) I ĐẠI CƯƠNG Sốt Dengue Sốt xuất huyết Dengue ... PHÁT HIỆN VÀ XỬ TRÍ ĐIỀU TRỊ SỐT DENGUE VÀ SỐT XUẤT HUYẾT DENGUE Ở TUYẾN CƠ SỞ KHI CÓ DỊCH Cần phải nghi ngờ dịch sốt Dengue, sốt xuất huyết Dengue cộng đồng thấy nhiều người bị sốt cao đột ngột ... đại làm nơi có điều kiện Labo Viện Vệ sinh Dịch tễ Trung ương,Viện Pasteur Thành phố Hồ Chí Minh, III ĐIỀU TRỊ Sốt Dengue Sốt xuất huyết Dengue độ I II Phần lớn trường hợp điều trị ngoại trú theo...
  • 23
  • 146
  • 0

Vai trò của đo áp lực bàng quang trong chẩn đoán và xử trí tăng áp lực ổ bụng trên bệnh nhi sốc sốt xuất huyết dengue

Vai trò của đo áp lực bàng quang trong chẩn đoán và xử trí tăng áp lực ổ bụng trên bệnh nhi sốc sốt xuất huyết dengue
... bụng giải áp dựa vào áp lực bàng quang xử trí tăng áp lực bụng bệnh nhi sốc SXHD có tăng áp lực bụng Xác định tỉ lệ biến chứng xảy đo áp lực bàng quang chọc dò bụng giải áp bệnh nhi sốc ... cậy áp lực bàng quang với áp lực bụng bệnh nhi sốc sốt xuất huyết Dengue tăng áp lực bụng 68 3.3 Kết chọc dò bụng giải áp dựa áp lực bàng quang 76 3.4 Các biến chứng đo áp lực bàng quang ... để chẩn đốn, xử trí tăng áp lực bụng hội chứng chèn ép bụng đo áp lực bụng [50] Áp lực bụng đo trực tiếp gián tiếp, ngắt qng liên tục Đo áp lực bụng trực tiếp: Phương pháp đo áp lực ổ...
  • 160
  • 720
  • 1

KHÓA LUẬN nghiên cứu mồi bả diệt muỗi truyền bệnh sốt denguesốt xuất huyết dengue aedes aegypti tại hà nội

KHÓA LUẬN nghiên cứu mồi bả diệt muỗi truyền bệnh sốt denguesốt xuất huyết dengue aedes aegypti tại hà nội
... trường, thực đề tài “ Nghiên cứu mồi bả diệt muỗi truyền bệnh sốt dengue /sốt xuất huyết dengue Aedes aegypti Nội Nguyễn Quang Huy – KSCNSH 0605 Viện Đại học Mở Nội Luận văn tốt nghiệp Đại ... Mở Nội Luận văn tốt nghiệp Đại Học Muỗi bị nhiễm virus Dengue truyền bệnh suốt vòng đời có loài muỗi Aedes gây bệnh chủ yếu Aedes aegypti Aedes albopictus Virus dengue truyền bệnh từ người bệnh ... với công tác nghiên cứu khoa học - Xác định hiệu mồi bả diệt muỗi truyền bệnh SD/SXHD Aedes aegypti Nội với công thức khác Nguyễn Quang Huy – KSCNSH 0605 Viện Đại học Mở Nội Luận văn tốt...
  • 52
  • 265
  • 0

Tài liệu Hướng dẫn Chẩn đoán, điều trị sốt Dengue và sốt xuất huyết Dengue của Bộ y tế pdf

Tài liệu Hướng dẫn Chẩn đoán, điều trị sốt Dengue và sốt xuất huyết Dengue của Bộ y tế pdf
... HƢỚNG DẪN NUÔI DƢỠNG SỐT DENGUE VÀ SỐT XUẤT HUYẾT DENGUE (Ban hành kèm theo Quyết định số 794/QĐ-BYT ng y 09 tháng năm 2009 Bộ trưởng Bộ Y tế) Nhu cầu dinh dƣỡng cho bệnh nhân sốt xuất huyết Dengue: ... bị mắc bệnh sốt Dengue sốt xuất huyết Dengue - Những việc cần làm trẻ bị mắc bệnh sốt Dengue sốt xuất huyết Dengue - Lí trẻ bị mắc bệnh cách phòng ngừa bệnh sốt Dengue sốt xuất huyết Dengue Kỹ ... ng y 09 tháng năm 2009 Bộ trưởng Bộ Y tế) I HƢỚNG DẪN CHĂM SÓC SỐT DENGUE VÀ SỐT XUẤT HUYẾT DENGUE Ở NGƢỜI LỚN KHÔNG SỐC (ĐỘ I, II) Đại cƣơng - Sốt Dengue sốt xuất huyết Dengue không sốc ngƣời...
  • 40
  • 492
  • 8

Tài liệu Bệnh sốt dengue và sốt xuất huyết có gì khác biệt? doc

Tài liệu Bệnh sốt dengue và sốt xuất huyết có gì khác biệt? doc
... gian truyền bệnh hai thể bệnh bệnh sốt dengue bệnh dengue sốt xuất huyết Bệnh sốt dengue thường bùng nổ thành vụ dịch, chủ yếu người lớn, làm cho hàng chục ngàn người bị nhiễm bệnh thường ... thôn diện loài muỗi truyền bệnh thích hợp Bệnh dengue sốt xuất huyết gọi gọn bệnh sốt xuất huyết, bệnh nguy hiểm, thường xảy vùng Đông Nam Á gần bệnh thấy xuất Nam Mỹ Nam Thái Bình Dương Bệnh ... từ 5-10% Hiện chưa vắc-xin phòng bệnh sốt dengue bệnh sốt xuất huyết nhiều nỗ lực nhà khoa học để tìm loại vắc-xin Bệnh chưa thuốc điều trị đặc hiệu Vì bệnh nhân hội chứng sốc cần...
  • 5
  • 169
  • 0

Tài liệu Báo cáo khoa học: PCR detection of nearly any dengue virus strain using a highly sensitive primer ‘cocktail’ ppt

Tài liệu Báo cáo khoa học: PCR detection of nearly any dengue virus strain using a highly sensitive primer ‘cocktail’ ppt
... CAAACCATGGAAGCTGTACG TTCTGTGCCTGGAATGATGCT CAAACCATGGAAGCTGTACG TTCTGTGCCTGGAATGATGCT GAGTGGAGTGGAAGGAGAAGGG CCTCTTGGTGTTGGTCTTTGC CAGACTAGTGGTTAGAGGAGA GGAATGATGCTGTAGAGACA ATATGCTGAAACGCGTGAG ... CAGACTAGTGGTTAGAGGAGA GGAATGATGCTGTAGAGACA ATATGCTGAAACGCGTGAG CATCATGAGACAGAGCGAT TTCCAACAAGCAGAACAACAT GCTACAGGCAGCACGGTTT Average efficiency ± SD Template Optimal PCR conditions Cocktail PCR conditions ... Primer sequence 5¢-Forward-3¢ 5¢-Reverse-3¢ CAAACCATGGAAGCTGTACG TTCTGTGCCTGGAATGATGCT CAAACCATGGAAGCTGTACG TTCTGTGCCTGGAATGATGCT GAGTGGAGTGGAAGGAGAAGGG CCTCTTGGTGTTGGTCTTTGC CAGACTAGTGGTTAGAGGAGA...
  • 12
  • 216
  • 0

Tài liệu Báo cáo khoa học: Progress for dengue virus diseases Towards the NS2B–NS3pro inhibition for a therapeutic-based approach ppt

Tài liệu Báo cáo khoa học: Progress for dengue virus diseases Towards the NS2B–NS3pro inhibition for a therapeutic-based approach ppt
... Pacific and the Americas A substantial number of people travelling to endemic regions are also infected each year In the last year, DHF has again been on the increase in India and in several Asian ... Melino and M Paci Progress for dengue virus diseases Table Vaccines against dengue fever by the Initiative for Vaccine Research, World Health Organization, updated February 2006 Type of vaccine ... Compound Ki value (lM) Reference a- keto-amide Amide Ac-FAAGRR -a keto–SL-CONH2 Ac-FAAGRR-CONH2 Ac-RTSKKR-CONH2 Ac-KKR-CONH2 Ac-FAAGRR-CHO Bz-Nle-Lys-Arg-Arg-H Bz-Ala-Lys-Arg-Arg-H Bz-Phe-Lys-Arg-Arg-H...
  • 17
  • 129
  • 0

Tài liệu Báo cáo khoa học: Diversity and junction residues as hotspots of binding energy in an antibody neutralizing the dengue virus doc

Tài liệu Báo cáo khoa học: Diversity and junction residues as hotspots of binding energy in an antibody neutralizing the dengue virus doc
... alanine scanning of the L-CDR3 and H-CDR3 loops of antibody mAb4E11 This scanning allowed us to identify the residues of these loops that contributed to the energetics and kinetics of the interaction ... on antibodies and their genes, and performed a systematic scanning of the CDR3 loops of mAb4E11 by mutagenesis of their residues into alanine (Ala scanning) The affinities of the purified mutant ... 0.5 residues were introduced during the formation of the VH-D and D-JH junctions, likely by the terminal deoxynucleotidyl transferase, and they translate into the amino-acid residues H-Gly95 and...
  • 13
  • 211
  • 0

Báo cáo khoa học: Human-blind probes and primers for dengue virus identification Exhaustive analysis of subsequences present in the human and 83 dengue genome sequences doc

Báo cáo khoa học: Human-blind probes and primers for dengue virus identification Exhaustive analysis of subsequences present in the human and 83 dengue genome sequences doc
... refer to the sequences that are present in the genome of interest and absent from the host genome as being ‘host-blind’ (human- blind, mosquito-blind, mouseblind, rat-blind, etc.) sequences The greater ... (22-mers) of the viral genome is comprised of n-mers that are not present in any of the other dengue genomes For example, in the genome of the DENV-4 China Guangzhou B5 strain (AF289029), 75.4% of the ... al Human- blind sequences for dengue identification just two of the dengue strains It is not until 19-mers were considered that all of the dengue genomes were found to have some human- blind sequences...
  • 11
  • 149
  • 0

Chi phí điều trị bệnh sốt dengue, sốt xuất huyết dengue tại bệnh viện

Chi phí điều trị bệnh sốt dengue, sốt xuất huyết dengue tại bệnh viện
... giảm chi phí bị bệnh Tất điều ảnh hưởng đến phần chi phí gián tiếp liên quan đến điều trị dengue, so sánh với nước khác 36 4.4 CHI PHÍ ĐIỀU TRỊ SỐT XUẤT HUYẾT Bảng 4.15 Chi phí điều trị dengue ... chẩn đốn bệnh phân loại dengue [14] Theo đó, dengue chia thành nhóm sốt dengue sốt xuất huyết dengue, chia sốt xuất huyết dengue thành mức độ từ nhẹ đến nặng Bệnh nhân Sốt dengue có biểu sốt 2-7 ... khu vực phía Nam cách kết hợp chi phí điều trị với số ca dengue ước tính thực 5 TỔNG QUAN TÀI LIỆU 2.1 SƠ LƯỢC VỀ BỆNH DENGUE Sốt dengue /Sốt xuất huyết Dengue, gọi tắt dengue, vi rút dengue gây...
  • 69
  • 746
  • 7

Xem thêm

Nạp tiền Tải lên
Đăng ký
Đăng nhập