lâm sinh học phần chung

GIÁO ÁN KỸ THUẬT LÂM SINH (HỌC PHẦN I)

GIÁO ÁN KỸ THUẬT LÂM SINH (HỌC PHẦN I)
... sương mù - Ánh sáng: + Là nhân tố thiếu nhân hom Ánh sáng tán xạ 40 50% ánh sáng toàn phần thích hợp cho trình rễ hom + Các loài khác yêu cầu ánh sáng khác nhau: Những ưa sáng yêu cầu ánh sáng cao ... dụng ánh sáng tự nhiên ánh sáng nhân tạo GV: Dùng ánh sáng tự nhiên cách thiết kế nhà nuôi cấy theo kiểu nhà kính bát giác, dùng ánh sáng nhân tạo hệ thống đèn chiếu sáng với chủng loại ánh sáng ... nhu cầu ánh sáng, thúc đẩy sinh trưởng chiều cao, đường kính, hoa kết giống + Việc tỉa thưa thực vào mùa sinh trưởng yếu hay ngừng sinh trưởng đánh dấu 3.4 Tạo tán - Tác dụng: Làm cho tán cân...
  • 113
  • 357
  • 3

Xác định đặc tính sinh học phân tử gen VP1 của các chủng virus vacxin viêm gan vịt ở Việt Nam và so sánh với một số chủng khác của thế giới

Xác định đặc tính sinh học phân tử gen VP1 của các chủng virus vacxin viêm gan vịt ở Việt Nam và so sánh với một số chủng khác của thế giới
... hệ gen xác định vị trí phân loại virus viêm gan vịt có mặt Việt Nam, tiến hành nghiên cứu đề tài: Xác định đặc tính sinh học phân tử gen VP1 chủng virus vacxin viêm gan vịt Việt Nam so sánh với ... BẢNG Xác định đặc tính sinh học phân tử gen VP1 chủng virus vacxin viêm gan vịt Việt Nam so sánh với số chủng khác giới DANH MỤC BẢNG MỞ ĐẦU 1.1 TÍNH ... chủng virus vacxin thu với số chủng virus vacxin cường độc khác giới để xác định mức độ tương đồng chủng so sánh - Phân tích mối quan hệ phả hệ chủng virus vacxin với chủng virus viêm gan vịt giới...
  • 9
  • 180
  • 4

Bước đầu ứng dụng kĩ thuật sinh học phân tử để đánh giá sự lƣu hành của một số chủng pseudomonas aeruginosa và staphilococcus aureus gây nhiễm trùng bệnh viện tại bệnh viện đa khoa trung ương

Bước đầu ứng dụng kĩ thuật sinh học phân tử để đánh giá sự lƣu hành của một số chủng pseudomonas aeruginosa và staphilococcus aureus gây nhiễm trùng bệnh viện tại bệnh viện đa khoa trung ương
... hụt phân đoạn so với chủng lại (Hình b đƣờng chạy số 3) Phân tích kết nghiên cứu cho phép rút kết luận sơ nhƣ sau, có chủng P aeruginosa chủng S aureus khác số chủng phân lập bệnh viện Đa khoa Trung ... xung quanh bệnh viện để có nhận xét khái quát thành phần chủng vi sinh vật gây bệnh, mối liên quan chủng mẫu phân lập khác nhau, sở đƣa đánh giá công tác phòng chống nhiễm trùng bệnh viện địa điểm ... kỹ thuật PCR chủng P aeruginosa (a) S aureus (b) KẾT LUẬN Bằng kỹ thuật RAPD, với mồi ngẫu nhiên xác định đƣợc có chủng P aeruginosa chủng S aureus khác số chủng đƣợc phân lập bệnh viện Đa khoa...
  • 6
  • 330
  • 8

Xác định đặc tính sinh học phân tử gen VP1 của các chủng virus vacxin viêm gan vịt ở việt nam và so sánh với một số chủng khác của thế giới

Xác định đặc tính sinh học phân tử gen VP1 của các chủng virus vacxin viêm gan vịt ở việt nam và so sánh với một số chủng khác của thế giới
... l: - Gi i trỡnh trỡnh t vựng gen VP1 c a cỏc ch ng virus vacxin hi n cú m t t i Vi t Nam - So sỏnh vựng gen VP1 c a ch ng virus vacxin thu ủ c v i m t s ch ng virus vacxin v c ng ủ c khỏc trờn ... i gen Trang 39 60 VP1 c a ch ng virus vacxin Ai C p (VxAC) 4.2 K t qu truy c p Ngõn hng gen qu c t s d ng chu i gen 61 VP1 c a ch ng virus vacxin x ng thu c (VxXT) 4.3 Cỏc ch ng virus viờm gan ... vựng gen VP1 c a ch ng virus 58 viờm gan v t VxAC nghiờn c u 4.7 Trỡnh t nucleotit v axit amin vựng gen VP1 c a ch ng virus 58 viờm gan v t VxXT nghiờn c u 4.8 So sỏnh trỡnh t nucleotit gen VP1...
  • 83
  • 153
  • 0

[Luận văn]tình hình bệnh viêm gan vịt do virus ở huyện hiệp hoà tỉnh bắc giang phân lập, khảo sát một số đặc tính sinh học của chủng virus gây bệnh và biện pháp phòng bệnh

[Luận văn]tình hình bệnh viêm gan vịt do virus ở huyện hiệp hoà   tỉnh bắc giang  phân lập, khảo sát một số đặc tính sinh học của chủng virus gây bệnh và biện pháp phòng bệnh
... virus huyện Hiệp Hoà - tỉnh Bắc Giang Phân lập, khảo sát số đặc tính sinh học chủng virus gây bệnh biện pháp phòng bệnh" 1.2 Mục tiêu nghiên cứu - Xác định thực trạng bệnh viêm gan vịt virus đàn vịt ... vịt nuôi huyện Hiệp Hoà - tỉnh Bắc Giang - Phân lập virus viêm gan vịt gây bệnh - Xác định số đặc tính sinh học chủng virus phân lập đợc - áp dụng số biện pháp phòng bệnh 1.3 ý nghĩa khoa học - ... Hepatitis Virus - DHV) Bệnh viêm gan vịt typ virus khác gây nên: virus viêm gan vịt typ I, virus viêm gan vịt typ II virus viêm gan vịt typ III 2.2.1 Virus viêm gan vịt typ I * Hình thái Virus viêm gan...
  • 93
  • 767
  • 5

PHáT HIệN CáC CHủNG CƯờNG ĐộC GUMBORO NGUồN GốC ÂU-Mỹ TạI VIệT NAM BằNG PHƯƠNG PHáP SINH HọC PHÂN Tử PHÂN TíCH GEN VP2

PHáT HIệN CáC CHủNG CƯờNG ĐộC GUMBORO NGUồN GốC ÂU-Mỹ TạI VIệT NAM BằNG PHƯƠNG PHáP SINH HọC PHÂN Tử PHÂN TíCH GEN VP2
... nh axít amin Kết phân tích phả hệ v nguồn gốc lần khẳng định hỗn hợp dòng /chủng nguồn gốc khác GSG4 NUCLEOTIDE 99 virus Gumboro Việt Nam Những chủng nguồn gốc ngoại lai, l chủng đợc đa từ ... trình by hình cho thấy, chủng phân chia thnh nhóm rõ rệt, đó, chủng GPT (Việt Nam) nhóm với chủng châu á, chủng BDG23 v chủng SGS4 (Việt Nam) nhóm với chủng châu ÂuMỹ, kể phân tích thnh phần nucleotit ... xuất Nông nghiệp, H Nội, Việt Nam (340 trang) Lê Thanh Ho (2004) Biến đổi phân tử epitope gen kháng nguyên VP2 số chủng virus cờng độc Gumboro phân lập Việt Nam Tạp chí Khoa học Kỹ thuật Thú y, Số...
  • 7
  • 175
  • 1

Luận văn khảo sát đặc tính sinh học phân tử của một số chủng virus viêm gan vịt cường độc phân lập được trên đàn vịt ở một số địa phương và so sánh với chủng virus vacxin DH EG 2000

Luận văn khảo sát đặc tính sinh học phân tử của một số chủng virus viêm gan vịt cường độc phân lập được trên đàn vịt ở một số địa phương và so sánh với chủng virus vacxin DH   EG   2000
... 2.1 B nh viêm gan virus 2.2 M t s ñ c tính c a virus viêm gan v t 12 2.3 Sinh h c phân t c a virus viêm gan v t 14 2.4 Mi n d ch ch ng virus viêm gan v t 19 2.5 Các k thu t sinh h c phân t 20 ... hành ñ tài: “Kh o sát ñ c tính sinh h c phân t c a m t s ch ng virus viêm gan v t cư ng ñ c phân l p ñư c ñàn v t m t s ñ a phương so sánh v i ch ng virus vacxin DH EG 2000 1.2 M c tiêu ... nh viêm gan v t ñ c tính sinh h c virus viêm gan v t v n chưa có nhi u công trình nghiên c u v ñ c tính sinh h c phân t c a virus viêm gan v t B nh viêm gan v t ñư c phát hi n l n ñ u tiên vào...
  • 84
  • 251
  • 0

Luận văn tình hình bệnh dịch tả vịt trên đàn vịt nuôi tại ngoại thành hà nội và một số tỉnh lân cận, phân lập, khảo sát đặc tính sinh học của chủng virus cường độc

Luận văn tình hình bệnh dịch tả vịt trên đàn vịt nuôi tại ngoại thành hà nội và một số tỉnh lân cận, phân lập, khảo sát đặc tính sinh học của chủng virus cường độc
... chống dịch bệnh cho đàn vịt đạt hiệu cao, tiến hành nghiên cứu đề tài: "Tình hình bệnh dịch tả vịt đàn vịt nuôi ngoại thành Nội số tỉnh lân cận Phân lập, khảo sát đặc tính sinh học chủng virus ... cờng độc" 1.2 Mục tiêu nghiên cứu - Xác định thực trạng bệnh dịch tả vịt đàn vịt nuôi ngoại thành Nội số tỉnh lân cận - Phân lập virus gây bệnh dịch tả vịt - Khảo sát số đặc tính sinh học chủng ... đại học nông nghiệp I Nguyễn Ngọc Điểm Tình hình bệnh dịch tả vịt đàn vịt nuôi ngoại thành Nội số tỉnh lân cận Phân lập, khảo sát đặc tính sinh học chủng virus cờng độc...
  • 109
  • 749
  • 4

Luận văn tình hình bệnh viêm gan vịt do virus ở huyện hiệp hoà tỉnh bắc giang phân lập, khảo sát một số đặc tính sinh học của chủng virus gây bệnh và biện pháp phòng bệnh

Luận văn tình hình bệnh viêm gan vịt do virus ở huyện hiệp hoà   tỉnh bắc giang  phân lập, khảo sát một số đặc tính sinh học của chủng virus gây bệnh và biện pháp phòng bệnh
... Hepatitis Virus - DHV) Bệnh viêm gan vịt typ virus khác gây nên: virus viêm gan vịt typ I, virus viêm gan vịt typ II virus viêm gan vịt typ III 2.2.1 Virus viêm gan vịt typ I * Hình thái Virus viêm gan ... cứu tình hình chăn nuôi vịt huyện Hiệp Hoà - Bắc Giang 3.1.2 Nghiên cứu tình hình bệnh viêm gan vịt virus đàn vịt nuôi huyện Hiệp Hoà - Bắc Giang 3.1.3 Phân lập virus viêm gan vịt định typ chủng ... đặc tính sinh học chủng virus gây bệnh biện pháp phòng bệnh" 1.2 Mục tiêu nghiên cứu - Xác định thực trạng bệnh viêm gan vịt virus đàn vịt nuôi huyện Hiệp Hoà - tỉnh Bắc Giang - Phân lập virus viêm...
  • 93
  • 303
  • 0

Luận văn nghiên cứu một số đặc tính sinh học phân tử của các chủng virus gây hội chứng rối loạn hô hấp và sinh sản(PRRS) phân lập tại vùng phụ cận hà nội

Luận văn nghiên cứu một số đặc tính sinh học phân tử của các chủng virus gây hội chứng rối loạn hô hấp và sinh sản(PRRS) phân lập tại vùng phụ cận hà nội
... Cn b nh 2.2.1 C u trỳc virus PRRS PRRSV l m t virus ARN chu i ủn dng, virus ủ c x p vo b Nidovirales, h Arteriviridae, chi Arterivirus [15] Virus cú c u trỳc g n gi ng v i virus gõy viờm kh p ng ... EMCV, virus gi d i (PRV), Porcine cytomegalovirus, Porcine respiratory coronavirus v Porcine paramyxovirus [1] Cỏc nh nghiờn c u ủó phõn l p virus t ph i, gan, lỏch v huy t ho c d ch c th l n sinh ... Northern American genotype g m nh ng virus thu c dũng B c M m tiờu bi u l ch ng virus B c M ATCC - VR2332 H gen c a virus g m khung ủ c m g i lờn mó húa cho protein c a virus g m GP1, GP2, GP3, GP4,...
  • 89
  • 636
  • 11

Tài liệu Cấu trúc sinh học phân tử của HBV - Ý nghĩa lâm sàng docx

Tài liệu Cấu trúc sinh học phân tử của HBV - Ý nghĩa lâm sàng docx
... khác virus - Tiểu thể Dane (còn gọi virion hoàn chỉnh) - Cấu trúc hình cầu - Cấu trúc hình ống CẤU TRÚC BỘ GEN CỦA HBV HBV cá phần vỏ với loại protein S,M,L (KN HBsAg) Một phần nhân với - Màng bọc ... capside - Sợi đôi DNA Phần nhân màng bọc gọi nucleocapsid (đủ thành phần để cấu tạo virion) Cả phần vỏ phần nucleocapside tạo virion thực CẤU TRÚC BỘ GEN CỦA HBV Bộ gen HBV cấu tạo từ phân tử DNA ... pre-C HBeAg (-) antiHBe(+) HBV DNA(+) Ý NGHĨA CỦA CÁC KHÁNG NGUYÊN TRONG LÂM SÀNG HBcAg HBcAg đoạn peptide tín hiệu nên không tiết khỏi tế bào gan, tìm thấy huyết bệnh nhân Ý NGHĨA CỦA CÁC KHÁNG...
  • 38
  • 205
  • 1

Nghiên cứu tổng hợp một số dẫn xuất của axit asiatic phân lập từ cây rau má [centella asiatica (l ) urban] và thăm dò hoạt tính sinh học của chúng

Nghiên cứu tổng hợp một số dẫn xuất của axit asiatic phân lập từ cây rau má [centella asiatica (l ) urban] và thăm dò hoạt tính sinh học của chúng
... tụi ch n ủ ti: Nghiờn c u t ng h p m t s d n xu t c a axit asiatic phõn l p t cõy rau mỏ [Centella asiatica (L. ) urban] v thm dũ ho t tớnh sinh h c c a chỳng M c tiờu nghiờn c u ch t ban ủ u ú ... khả phản ứng chất Chất axit hữu có tính axit yếu chúng khó tham gia phản ứng trực tiếp với axit amin để tạo hợp chất amit Chúng phản ứng dễ dàng với axit amin hoạt hoá nhóm axit cách cho 39 tác ... cao (HR-ESI-MS); ph c ng h ng t Ph m c Th ng, Hunh Th Thanh Tõm v Ung Th Nh Truy n (201 1) T ng h p m t s d n xu t c a axit Asiatic phõn l p t cõy rau mỏ [Centella asiatica (L. ) Urban.] c a Vi...
  • 13
  • 317
  • 1

Phân tích đặc điểm sinh học phân tử gen NP, gen m và gen NS của một số chủng virus cúm a h5n1 mới xuất hiện năm 2011 tại việt nam

Phân tích đặc điểm sinh học phân tử gen NP, gen m và gen NS của một số chủng virus cúm a h5n1 mới xuất hiện năm 2011 tại việt nam
... xuất n m 2011 Việt Nam Với m c tiêu sau: 1- Thu nhận phân đoạn gen NP, M, NS giải trình trình tự phân đoạn gen số chủng virus c m A/ H5N1 phân lập từ bệnh ph m gây bệnh c m gia c m Việt Nam n m 2011 ... ATGCCCAAGCAGAAAGTGGTGGGTTCCCTTTGCATCAAAATGGACCAGGCAATGATGGATAAAACCGTCATATTG M P K Q K V V G S L C I K M D Q A M M D K T V I L> > TRANSLATION OF Dk-VN-QT800 -2011 NS1 (678BP) 380 * 400 * 420 * 440 * AAAGCAAACTTCAGTGTGATTTTTGACCGATTAGAAACCCTAATACTGCTTAGAGCTTTCACAGAAGAAGGAGCA ... 400 * 420 * 440 * AAAGCAAACTTCAGTGTGATTTTTGACCGATTAGAAACCCTAATACTGCTTAGAGCTTTCACAGAAGAAGGAGCA K A N F S V I F D R L E T L I L L R A F T E E G A> TRANSLATION OF Dk-VN-QT800 -2011 -NS1 (678BP) > 460...
  • 32
  • 185
  • 0

Báo cáo "Phát hiện các chủng cường độc Gumboro nguồn gốc Âu - Mỹ tại Việt Nam bằng phương pháp sinh học phân tử phân tích gen VP2 " doc

Báo cáo
... Sommer - Wagner (2007) Chủng BDG23 vị trí tơng ứng 222, 242, 253, 256, 279, 284, 294, 299, v 329 có axít amin l P - V - Q - V - D - A - I - N - A, thuộc môtíp P - V - Q - V - D - A - L -N - R l ... trình by hình cho thấy, chủng phân chia thnh nhóm rõ rệt, đó, chủng GPT (Việt Nam) nhóm với chủng châu á, chủng BDG23 v chủng SGS4 (Việt Nam) nhóm với chủng châu ÂuMỹ, kể phân tích thnh phần nucleotit ... (2006) Tách dòng v phân tích biến đổi thnh phần chuỗi gen VP 2-4 -3 (phân đoạn A) virus cờng độc Gumboro chủng GHUT-12 Việt Nam Tạp chí Công nghệ Sinh học, Số 4, Tập 2, tr 17 1-1 78 Nicholas K.B and...
  • 7
  • 192
  • 0

Nghiên cứu giải mã một phần hệ gen ty thể của loài sán lá gan nhỏ Opisthorchis viverrini (mẫu Việt Nam) và so sánh với các chủng của thế giới bằng các phương pháp sinh học phân tử

Nghiên cứu giải mã một phần hệ gen ty thể của loài sán lá gan nhỏ Opisthorchis viverrini (mẫu Việt Nam) và so sánh với các chủng của thế giới bằng các phương pháp sinh học phân tử
... thit thc v nghiờn cu gen hc h gen ty th ó nờu trờn, chỳng tụi tin hnh ti: Nghiờn cu gii mó mt phn h gen ty th ca loi sỏn lỏ gan nh Opisthorchis viverrini (mu Vit Nam) v so sỏnh vi cỏc chng ca ... Cha cú ton b h gen ty th gii trỡnh mt cỏch hon chnh no ca O viverrini c ng ký vo Ngõn hng gen Nh vy, t l cn cú d liu sinh hc phõn t h gen ty th cng nh ca h gen nhõn ca sỏn lỏ gan nh ca Vit Nam ... truyn h gen ty th 1.2 H GEN TY TH V NG DNG TRONG NGHIấN CU Kí SINH TRNG Hin ó cú rt nhiu loi ó cú h gen ty th c gii mó ton b hoc mt phn, cung cp nguyờn liu chui nucleotide v amino acid cho so sỏnh...
  • 27
  • 291
  • 0

Xem thêm

Từ khóa: bằng chứng tiến hóa sinh học phân tửbằng chứng sinh học phân tử là gìhãy tìm một số bằng chứng sinh học phân tửbằng chứng về sinh học phân tửbằng chứng tế bào học và sinh học phân tửcác bằng chứng sinh học phân tửmột số đặc tính sinh hoá miễn dịch và sinh học phân tử của các chủng bacillus du và nt trong sản xuất các sinh phẩmcấu trúc sinh học phân tử của hbv ý nghĩa trong lâm sàngđịnh danh sinh học phân tử chủng lb7phân loại các chủng nấm nội sinh bằng phƣơng pháp hình thái và bằng phƣơng pháp sinh học phân tửphân loại chủng nấm nội sinh ks14 bằng phương pháp sinh học phân tửsinh học phân tửsinh học phân tửkỹ thuật sinh học phân tửtiểu luận sinh học phân tửwhat is she doinglondon old and newapollo moon landingbase and strong adjectivesbatman new video game to explain comparisondays and monthsTính duy nhất của hàm đa điều hòa dướigoing to gamehộp số tự động trên xe chevrolet captivaKhóa luận nghiên cứu kỹ thuật khai phá dữ liệu và ứng dụng trong hệ thống bán sách trực tuyếnPhân tích thực trạng và giải pháp nâng cao hiệu quả đầu tư xây dựng tại tổng công ty điện lực miền bắcmoon landing conspiracy theorymy alphabetpersonalty adjectvessaying hello and meeting each otherTrắc nghiệm chương 3 đại số 11 ( có đáp án)unit animalsBài tập lớn quản lý chất lượng Quy đinh lập và theo dõi mục tiêu chất lượngunit travellingwhat is he doing
Nạp tiền Tải lên
Đăng ký
Đăng nhập