báo cáo hoá sinh hemoglobin myoglobin

Báo cáo Hoá sinh thực phẩm Hemoglobin-Myoglobin

Báo cáo Hoá sinh thực phẩm Hemoglobin-Myoglobin
... Phân cơng thực Nội dung Chương 1: Hemoglobin I Giới thiệu II Cấu tạo hố học III Chức sinh học Hemoglobin IV Tính chất Hemoglobin Chương 2: Myoglobin I Giới thiệu II Cấu tạo hố học III Chức sinh học ... (a2b2) • Người lớn : HbA, HbA2 ( a2d2), HbF Túi nỗn hồn tuổi thai (tuần) Latch Gan sinh ~ 12 ~ tuỷ xương Sau sinh (tuần) Hemoglobin Myoglobin GVHD: TS Trần Bích Lam Bảng 1: Thành phần hemoglobin ... thiệu: Myoglobin protein có kiến trúc hóa học tương đối đơn giản Sự phân phối myoglobin sinh vật phản ảnh chức vụ sinh lý : có nhiều cầm thú chun lặn lâu nước (cá voi, cá heo, hải cẩu, v.v…) mơ tim...
  • 28
  • 789
  • 3

Báo cáo hóa sinh thực hành

Báo cáo hóa sinh thực hành
... đặc trưng fructose cetohexose không nhạy aldohexoz - 2010 - 15 Thực hành Hóa Sinh Lớp K14S1_Nhóm 2_tổ - 2010 - 16 Thực hành Hóa Sinh Lớp K14S1_Nhóm 2_tổ Bài 3: XÁC ĐỊNH ĐƯỜNG KHỬ BẰNG PHƯƠNG ... “Absorbance” với độ dài sóng 690nm - 2010 - 17 Thực hành Hóa Sinh Lớp K14S1_Nhóm 2_tổ  Đồ thị theo nồng độ đường độ hấp thu - 2010 - 18 Thực hành Hóa Sinh Lớp K14S1_Nhóm 2_tổ Chương IV: VITAMIN ... 2010 - 14 Thực hành Hóa Sinh Lớp K14S1_Nhóm 2_tổ Bài 2: PHẢN ỨNG SELIWANOFF I) Nguyên tắc: − Khi trộn dd acid ascorbic với dd xanh metylen dd màu Phản ứng xảy acid ascorbic bị oxi hóa thành acid...
  • 29
  • 17,796
  • 62

Báo cáo hóa sinh các con đường sinh tổng hợp acid amin ở vi sinh vật

Báo cáo hóa sinh các con đường sinh tổng hợp acid amin ở vi sinh vật
... 12 Các đường sinh tổng hợp acid amin vi sinh vật Nhóm CHƯƠNG 2: CÁC CON ĐƯỜNG SINH TỔNG HỢP ACID AMIN VI SINH VẬT SƠ ĐỒ CHUYỂN HÓA CÁC ACID AMIN VI SINH VẬT Trang 13 Các đường sinh tổng hợp ... sinh tổng hợp phản ứng amin hóa trực tiếp gọi sinh tổng hợp sơ cấp acid amin 1.3.2 .Sinh tổng hợp acid amin phản ứng chuyển amin Phản ứng chuyển amin đường hướng sinh tổng hợp acid amin vi sinh vật ... hệ trình tổng hợp acid amin thơm vitamine E coli Trang 46 Các đường sinh tổng hợp acid amin vi sinh vật Nhóm 2.3.1 Tổng hợp tiền chất trung gian Chosrimate Hình 2.13 Con đường sinh tổng hợp Chorismate...
  • 55
  • 607
  • 3

Báo cáo Hóa Sinh Chủ đề Ceride

Báo cáo Hóa Sinh Chủ đề Ceride
... viên: Hồ Xuân An Võ Thị Trang Anh Trần Hữu Cảnh Nội dung báo cáo Cấu tạo ceride Vai trò ceride Một số đặc tính ceride Cấu tạo ceride Ceride (thường gọi sáp) ester rượu acid béo, nhiệt độthường ... cho lá, khỏi bị thấm nước, ngăn ngừa vi sinh vật thâm nhập vào - Lalolin dùng nhiều y học, công nghệ mĩ phẩm Một số sản phẩm làm từ sáp Một số đặc tính ceride • Sáp chất rắn nhiệt độ thường,không ... Axit montanic (28 cacbon) : CH3(CH2)26COOH - Axit melisxic (30 cacbon): CH3(CH2)28COOH Vai trò ceride - Sáp có tác dụng bảo vệ Chẳng hạn sáp ong bảo vệ cho ấu trùng ong phát triển bình thường...
  • 11
  • 152
  • 0

Báo cáo hóa học: " S110, a novel decitabine dinucleotide, increases fetal hemoglobin levels in baboons (P. anubis)" potx

Báo cáo hóa học:
... Hind III The g-globin gene promoter region was amplified by two rounds of PCR using semi-nested primers The primer set BG1 (TATGGTGGGAGAAGAAATTAGTAAAGG) and BG2 (AATAACCTTATCCTCCTCTATAAAATAACC) ... observed in patients with sickle cell disease treated with decitabine [5] Pharmacokinetic analysis A summary of the pharmacokinetic data obtained is presented in Table In baboons treated with S110, ... levels in baboons Kinetics of change in fetal hemoglobin levels during treatment with decitabine and S110 in PA 7256 and 7470 animals were treated with either S110 or decitabine between days 1-10...
  • 8
  • 170
  • 0

báo cáo hóa học:" Serum heavy metals and hemoglobin related compounds in Saudi Arabia firefighters" pot

báo cáo hóa học:
... baseline carboxyhemoglobin of non-smoking firemen and smoking firemen A consistent increase in mean COHb levels after exposure to smoke was seen in both non-smoking and smoking men, but the mean increase ... Iron, Total Iron Binding Capacity, Transferrin saturation percent, Ferritin, Unsaturated Iron-Binding Capacity Blood Hemoglobin and Carboxyhemoglobin,) Ten milliliters of fasting venous blood ... carboxyhemoglobin readings were collected during training exercises The mean and median carboxyhemoglobin levels were 1% The maximum value in a firefighter wearing self-contained breathing apparatus...
  • 6
  • 151
  • 0

Báo cáo Hóa học gống và vi sinh vật

Báo cáo Hóa học gống và vi sinh vật
... soát quần thể vi sinh vật đường ruột - Không hại đến tế bào niêm mạc ruột sinh vật chủ - Có tác dụng ngăn cản vi sinh vật gây bệnh - Phải đạt yêu cầu, qui định an toàn sinh học, vệ sinh thực phẩm ... NTTS Trường đại học NN Hà Nội Khóa luận tốt nghiệp Đàm Thị Hoa-CNTYA K54 vi sinh vật sống sử dụng cho người động vật mang lại ảnh hưởng có lợi cho sinh vật chủ cách cải thiện hệ sinh vật đường ruột ... (2008) Giáo trình vinh sinh vật đại cương, NXB nông nghiệp Tô Minh Châu (2000) Vi sinh vật ứng dụng chăn nuôi, Tủ sách trường Đại học Nông Lâm Nguyễn Như Thanh (2004) Vi sinh vật đại cương, NXB...
  • 49
  • 60
  • 0

BÁO cáo tổ SINH hóa năm học 2013

BÁO cáo tổ SINH hóa năm học 2013
... Hồng Thái Sinh 0 Cao Thị Hưởng Hóa 0 Tô Phúc Lai Sinh 0 Bùi Thị Cúc Hóa 0 Tô Quang Hóa Sinh 0 Trần Anh Hùng Hóa 0 Phạm Thị Thanh Hương Hóa 0 Nguyễn Minh Trọng Sinh 0 Nguyễn Trần Huỳnh Lê Hóa 0 10 ... đề tổ : Kỹ thuật thiết kế giảng theo chuẩn E-learning phần mềm Adobe presenter 7.0 10.Thực chương trình ( ghi rõ số tiết trễ chương trình đến cuối năm ) STT Họ tên giáo viên Môn- khối Chính khóa ... STT Họ tên giáo viên Cao Thị Hưởng Tô Phúc Lai Bùi Thị Cúc Tô Quang Hóa Trần Anh Hùng Phạm Thị Thanh Hương Nguyễn Minh Trọng Nguyễn Trần Huỳnh Lê Chế Hoàng Thanh Liêm...
  • 3
  • 200
  • 0

Báo cáo vệ sinh chăn nuôi

Báo cáo vệ sinh chăn nuôi
... - Nuôi cấy 370C/24h + Nếu xảy trình lên men, sinh hơi: đẩy ống Durham, làm đục nước, môi trường xanh chuyển qua vàng + Kết ống nghiệm lên men sinh hơi: ống dương tính ( + )  Sau thời gian nuôi ... gian nuôi cấy, kết thu sau:  Có ống lên men sinh hơi, thứ tự 1  Tra bảng: có 20 Coliforms tổng số  Tuy nhiên có mặt Coliforms tổng số chưa đánh giá vệ sinh nguồn nước Do vậy, tiến hành thí nghiệm ... mẫu chưa vệ sinh kĩ Thí nghiệm 3: Khẳng định có mặt E.Coli phân (Vi khuẩn màu tim ánh kim ) - Cấy ống dương tính vào môi trường EMB ( thạch đĩa ) 370C/24h - Kết quả: + Sau thời gian nuôi cấy,...
  • 7
  • 418
  • 2

bai báo cáo vi sinh

bai báo cáo vi sinh
... phổi (PCV) 2.5 MEN VI SINH 2.5.1 Khái niệm phân loại Men vi sinh số vi khuẩn có ích thể người, vi khuẩn thường sống ruột Các loại men vi sinh: - Lactobacillus sporogenes vi sinh sản xuất acid ... Các đối tượng vi sinh vật tham gia Vacxin virus vi khuẩn sống, giảm độc lực, đưa vào thể không gây bệnh gây bệnh nhẹ Vacxin vi sinh vật bị bất hoạt, chết sản phẩm tinh chế từ vi sinh vật 2.4.3 ... khang -sinh vi vietsciences1.free.fr/vietscience/ /nguyenlandung/chuong20.pdf suckhoebeyeu.com/ y /37-men -vi- sinh- phng-phap-phong-bnh-mi www.vast.ac.vn/index.php? 1106%3Anghien khang -sinh vi duoclieuvietnam.com/...
  • 28
  • 203
  • 0

Báo cáo hóa phân tích khoa môi trường đại học Đà Lạt

Báo cáo hóa phân tích  khoa môi trường đại học Đà Lạt
... chuẩn pha KMnO4 Sử dụng dung dịch chuẩn vừa pha để định phân dung dịch sắt (II) đồng thời tăng cường kỹ cho trình thực hành phân tích môi trường thực tế III Tính toán kết pha chế hoá chất Pha chế ... Toán kết pha chế hoá chất: Kết báo cáo kết quả: Trả lời câu hỏi giải tập: Trang : 17 Trang : 17 Trang : 17 Trang : Mục đích: Tính Toán kết pha chế hoá chất: Kết báo cáo kết quả: Trả lời câu hỏi ... Tính Toán kết pha chế hoá chất: Kết báo cáo kết quả: Trả lời câu hỏi giải tập: Trang : Trang : Trang : Trang : Mục đích: Tính Toán kết pha chế hoá chất: Kết báo cáo kết quả: Trả lời câu hỏi giải...
  • 36
  • 475
  • 1

báo cáo hóa dầu

báo cáo hóa dầu
... sợi co dãn Giấy thấm dầu sản xuất từ vật liệu polypropylene có tác dụng thấm dầu loang mặt nước Phao quây dầu : Chuyên dùng để quây chặn thấm hút dầu tràn vãi không cho vệt dầu lan rộng bề mặt ... dầu (Absorbent Pillows): Dùng làm lớp lọc dầu lẫn nước thải công nghiệp hay đặt vị trí có dầu rò rỉ để thấm hút dầu Gối thấm làm với kích thước độ dày khác tuỳ theo mục đích sử dụng (để lọc dầu ... dầu hay thấm dầu) , hay theo yêu cầu riêng khách hàng, kg sản phẩm hút 18 kg dầu Giấy thấm dầu (Absorbent Wipes): Giấy thấm dầu sản xuất từ vật liệu polypropylene có tác dụng thấm dầu loang mặt...
  • 46
  • 161
  • 0

Báo cáo vệ sinh an toàn thực phẩm

Báo cáo vệ sinh an toàn thực phẩm
... Chi cục An toàn Vệ sinh thực phẩm mở lớp đào tạo, tập huấn giao ban thờng kỳ công tác VSATTP trang bị, thiết bị văn phòng cho Khoa An toàn vệ sinh thực phẩm để hoạt động thuận lợi Trên báo cáo công ... khác IV Đánh giá chung Ưu điểm Công tác vệ sinh an toàn thực phẩm năm 2011 có bớc chuyển biến rõ rệt, vai trò tham mu Trung tâm Y Tế đợc chủ động cao, quan tâm công tác VSATTP nhà quản lý, Chính ... cấp đợc nêu cao trọng, ý thức ngời sản xuất, kinh doanh, chế biến thực phẩm nh ngời tiêu dùng đợc lên tháng đầu năm 2011 tợng ngộ độc thực phẩm xảy cộng đồng Yếu tồn - Phơng tiện tra, kiểm tra,...
  • 5
  • 5,170
  • 16


... …… III Trung cấp chuyên nghiệp - Nữ - Dân tộc người Phân theo ngành đào tạo năm đào tạo Ngành - Năm thứ - Năm ... theo Danh mục Giáo dục, đào tạo Việt Nam ban hành theo Quyết định số 38/2009/QĐ-TTg ngày 09 tháng năm 2009 Thủ tướng Chính phủ - cấp ……, ngày … tháng … năm … Người lập biểu (Ký, họ tên) Người kiểm...
  • 2
  • 176
  • 0

bao cao hoc sinh ca nam

bao cao hoc sinh ca nam
... chưa cao Một số giáo viên chưa thực quan tâm tới lớp ,chưa kòp thời chấn chỉnh vi phạm nội quy trường lớp mà học sinh gây IV/ Chất lượng học tập- hạnh kiểm học sinh - Học lực : Đại đa số học sinh ... thành lập QĐND Việt nam + Hoạt động đội : Học Kì I vừa qua liên đội tổ chức tặng áo trắng cho học sinh nghèo vượt khó ,tổ chức hội thi văn nghệ chào mừng ngày nhà giáo việt nam. tổ chức hội thi ... thành lập QĐND Việt nam + Hoạt động đội : Học Kì I vừa qua liên đội tổ chức tặng áo trắng cho học sinh nghèo vượt khó ,tổ chức hội thi văn nghệ chào mừng ngày nhà giáo việt nam. tổ chức hội thi...
  • 4
  • 119
  • 0

Xem thêm

Từ khóa: báo cáo hóa sinhbao cao hoa sinh dai cuongbao cao hoa sinh mo cobáo cáo hóa họcbao cao vi sinhbáo cáo vi sinh môi trườngbáo cáo ngành sinh họcbáo cáo hóa dầubáo cáo vi sinh ứng dụngbáo cáo hoa cây cảnhbáo cáo vệ sinh an toàn thực phẩm trong trường họcbáo cáo tuần sinh hoạt công dân hssvbai bao cao vi sinh vatbao cao vi sinh vatbao cao vi sinh moi truongĐO LƯỜNG và điều KHIỂNquản trị chiến lượcÁp dụng thẻ điểm cân bằng tại các doanh nghiệp dịch vụ Việt Nambài tập điều khiển tự độngKHÍ TƯỢNG THỦY văn HÀNG hảiBẢO TỒN, PHÁT HUY GIÁ TRỊ KHU DI TÍCH TRUNG TÂM HOÀNG THÀNH THĂNG LONG - HÀ NỘICải biến vectơ hệ Virut Semliki Forest (SFV) nhằm biểu hiện thụ thể GPCR của người Việt NamCải cách kinh-tế-ở-Trung-Quốc-sau-khi-gia-nhập-tổ-chức-thương-mại-thế-giới-_WTO_-và-những-gợi-ý-về-c_GIÁO TRÌNH VỀ VẼ TÀUCharacteristic of urban wastewaterin Hanoi City – nutritive value and potential risk in using for agricultureĐA DẠNG VỀ CHUYỂN ĐỔI CƠ CẤU KINH TẾ NÔNG NGHIỆP NÔNG THÔN THEO VÙNG KINH TẾ Ở VIỆT NAMĐặc điểm hình sự của tội phạm trong lĩnh vực hoàn thuế giá trị gia tăng và giải pháp phòng ngừaĐặc điểm và biến động cấu trúc sử dụng đất huyện Thạch ThấtDevelopment of cooperative research on assessment of climate change impacts on water resources of Vietnam-China transboundary river basinsDevelopment of Laser Beam Diffraction Technique for Determination of Thermal Expansion Coefficient of Polymeric Thin Filmsđiều khiển thủy khíDoanh nhân Việt Nam với vấn đề nắm bắt cơ hội kinh doanhĐÔI ĐIỀU VỀ VĂN HÓA HÀ NỘI THỜI HỘI NHẬP QUỐC TẾĐổi mới kiểm tra đánh giá Từ thực tế của các lớp bồi dưỡng tiếng Anh cho giáo viên tiểu họcEffect of Secondary Structure on Biological Activities of Antimicrobial Peptides
Nạp tiền Tải lên
Đăng ký
Đăng nhập