Bài thuyết trình Phát hiện nhanh chóng và chuyên biệt cho loài mới Xanthomonas oryzae pv. oryzae K3a bằng phương pháp PCR dựa vào Marker có nguồn gốc từ phương pháp AFLP.

Bài thuyết trình phát triển, duy trì sản xuất hạt của các giống ngô thụ phấn tự do

Bài thuyết trình phát triển, duy trì và sản xuất hạt của các giống ngô thụ phấn tự do
... trì sản xuất hạt giống cấp tác giả  sở cấp chứng hạt giống Duy trì sản xuất hạt giống (Maintenance and Seed Production )  Duy trì sản xuất hạt giống giống TPTD chia thành giai đoạn sản xuất ... hệ tống phóng thích giống Đặc điểmcả giống th phấn tự Duy tr sản xuất hạt giống       Sự phù hợp giống thụ phấn tự Những thay đồi khái nệm giống thụ phấn tự Lưu giữ giống gốc Lựa chọn ... chuẩn hạt giống  Kỹ thuật sản xuất hạt giống ngô lai có nhiều công bố  Nhưng sản xuất hạt giống ngô thụ phấn tự hạn chế Nội dung  Giới thiệu    Phát triển giống, đánh giá đặc điểm     Hạt...
  • 42
  • 63
  • 0

BÀI THUYẾT TRÌNH ĐƯỜNG lối xây DỰNG PHÁT TRIỂN nền văn HOÁ

BÀI THUYẾT TRÌNH ĐƯỜNG lối xây DỰNG và PHÁT TRIỂN nền văn HOÁ
... đặc trưng văn hóa mà cần xây dựng; chức năng, vai trò vị trí văn hóa phát triển kinh tế - xã hội hội nhập quốc tế 2) Quan điểm đạo chủ trương vể xây dựng phát triển văn hóa: Một là, văn hóa tảng ... đẩy phát triển kinh tế xã hội Hai là, văn hóa mà ta xây dựng văn hóa tiên tiến, đậm đà sắc dân tộc Ba là, văn hóa Việt Nam văn hóa thống mà đa dạng cộng đồng dân tộc Bốn là, xây dựng phát triển ... 1955-1986: Đại hội lần thứ III (1960) đường lối xây dựng phát triển văn hóa giai đoạn cách mạng XHCN bắt đầu hình thành, chủ trương tiến hành cách mạng tư tưởng văn hóa đồng thời với cách mạng quan...
  • 51
  • 1,430
  • 21

Bài thuyết trình: Phát xạ lạnh (kính hiển vi STM)

Bài thuyết trình: Phát xạ lạnh (kính hiển vi STM)
... thanhlam1910_2006@yahoo.com KÍNH HIỂN VI ĐIỆN TỬ XUN HẦM (STM) 1.NGUN LÝ HOẠT ĐỘNG 2.CẤU TẠO CỦA STM • Hệ khí • Hệ chống rung • Hệ điều khiển phản hồi • Đầu dò STM 3.ỨNG DỤNG Lịch sử Kính hiển vi điện tử xun hầm phát triển ... Zürich năm 1981 Gerd Binning Heinrich Rohrer sau hai người đoạt giải Nobel vật lý năm 1986 phát minh kính hiển vi Gerd Binning Heinrich Rohrer NGUN LÝ HOẠT ĐỘNG °Dựa nguyên lý xuyên hầm lượng tử điện ... cách giửa mẫu tip) tỉ lệ thuận với lượng điện tử W The Scanning Tunneling Microscope (STM) STM kính hiển vi điện tử đầu dò có độ phân giải đạt đến ngun tử Quantum Tunneling Classical Wave Function...
  • 29
  • 212
  • 0

Hoàn thiện quy trình phát hiện nhanh Bacillus cereus Escherichia coli, trong sữa tiệt trùng với sự hỗ trợ của kỹ thuật Real Time PCR.DOC

Hoàn thiện quy trình phát hiện nhanh Bacillus cereus và Escherichia coli, trong sữa tiệt trùng với sự hỗ trợ của kỹ thuật Real Time PCR.DOC
... tạp Sự chậm trễ phương pháp làm tổn thất lớn cho nhà máy có cố nhiễm VSV Đề tài Hoàn thiện quy trình phát nhanh Bacillus cereus Escherichia coli, sữa tiệt trùng với hỗ trợ kỹ thuật Real Time ... Sử dụng kỹ thuật Real time PCR để phát nhanh hai vi sinh vật lựa chọn với độ nhạy CFU/25ml • Đã hoàn thiện quy trình phát nhanh Bacillus cereus Escherichia coli sữa tiệt trùng II HƯỚNG PHÁT TRIỂN ... QUẢ VÀ THẢO LUẬN I Đề xuất phương án hoàn thiện quy trình phát B .cereus E.coli sữa tiệt trùng Quy trình xây dựng Từ tài liệu tham khảo, em nhận thấy người trước nghiên cứu đưa quy trình phát nhanh...
  • 47
  • 275
  • 0

Bài thuyết trình phát triển nông nghiệp, thủy lợi các áp lực nguồn nước trong lưu vực sông mekong

Bài thuyết trình phát triển nông nghiệp, thủy lợi và các áp lực nguồn nước trong lưu vực sông mekong
... quan  Sông Mekong đóng góp lớn phát triển KT – XH cho lưu vực  Tài nguyên nước sông Mekong khai thác sử dụng ngày nhiều trình phát triển kinh tế - xã hội quốc gia lưu vực sông  Chính trình ... khí hậu thuận lợi cho phát triển nông nghiệp • Áp lực gia tăng dân số nhu cầu lương thực lưu vực sông Mekong ngày tăng cao, • Do gia tăng phát triển nông nghiệp ưu tiên kế hoạch phát triển quốc ... phục vụ nông nghiệp Dự án Kok Ing Yom Nan  Chuyển nước từ hai phụ lưu sông Mekong sông Kok sông Ing vào hai sông Yom sông Nan – hai phụ lưu sông Chao Phraya Dự án chuyển nước từ sông Mekong...
  • 39
  • 67
  • 0

Hoàn thiện quy trình phát hiện nhanh bacillus cereus escherichia coli, trong sữa tiệt trùng với sự hỗ trợ của kỹ thuật real time PCR

Hoàn thiện quy trình phát hiện nhanh bacillus cereus và escherichia coli, trong sữa tiệt trùng với sự hỗ trợ của kỹ thuật real time PCR
... Hình 3. Sơ đồ một số phương pháp của kỹ thuật Real Time PCR Hình 4. Đồ thị chuẩn hóa của phản ứng Real time PCR Hình 5. Quy trình phát hiện Bacillus E.coli trên sữa tiệt trùng không  đường ở mật độ nhiễm ban đầu 1CFU/1ml  Hình 6. Quy trình phát hiện Bacillus trên sữa tiệt trùng không đường ở  ...  xác định được nhiều gen đích ( vi sinh vật) trong cùng  một thời điểm với mức độ chính xác cao thời gian nhanh chính xác 3. Phương pháp phát hiện vi sinh vật bằng kỹ thuật Real Time PCR   Nguyên tắc Kỹ thuật Real Time PCR hay còn gọi là PCR động về cơ bản dựa trên ...  giải quy t hậu quả của sự  nhiễm tạp. Sự  chậm trễ  của phương pháp này sẽ  làm tổn thất lớn cho các nhà máy khi có sự  cố  nhiễm VSV Đề  tài  Hoàn thiện quy trình phát hiện nhanh Bacillus cereus ...
  • 20
  • 31
  • 0

Xây dựng Quy trình phát hiện Escherichia Coli trong thực phẩm bằng phương pháp PCR(Polumerase Chain Reaction) thử nghiệm ứng dụng

Xây dựng Quy trình phát hiện Escherichia Coli trong thực phẩm bằng phương pháp PCR(Polumerase Chain Reaction) và thử nghiệm ứng dụng
... phản ứng PCR cho phép phát 2.7 Quy trình mật E 103 CFU/ml hay 3CFU/ ng phươngPCR PCR E coli phát độ x coli thực phẩm bằ phản ứng pháp Căn vào kết thí nghiệm trên, đề nghò qui trình PCR để phát ... TSB Gây nhiễm E coli mật độ Ủ 370C 24 Phát E coli Phát E coli phương pháp truyền thống phươngpháp PCR Hình Sơ đồ khảo sát giới hạn phát E coli mẫu thực phẩm gây nhiễm theo phương pháp truyền thống ... lây nhiễm dẫn đến biến chứng CÁC PHƯƠNG PHÁP PHÁT HIỆN E COLI TRONG THỰC PHẨM 3.1 Phương pháp nuôi cấy truyền thống [6,10] Phương pháp nuôi cấy truyền thống để phát E coli gồm ba bước: (1) tăng...
  • 67
  • 711
  • 6

BÀI THUYẾT TRÌNH: Phát triển dòng xe Nouvo mới cho công ty Yamaha Motor

BÀI THUYẾT TRÌNH: Phát triển dòng xe Nouvo mới cho công ty Yamaha Motor
... Việt Nam * Vài nét về Công ty YAMAHA Việt Nam:   Tên  Công ty:   Công ty  TNHH  Yamaha Motor Việt Nam Tên Tiếng Anh: Yamaha Motor Vietnam Co., Ltd (YMVN)  *Trụ sở công ty:    Số 6 Thái Phiên, P.Lê Đại Hành, Hà Nội   ... * Vốn pháp định: 37.000.000 USD. Trong đó:  + Công ty TNHH Yamaha Motor Nhật Bản: 46%  + Tổng công ty Lâm nghiệp Việt Nam: 30%  + Công ty công nghiệp Hong Leong Malaysia: 24%  * Sản Phẩm  - Xe máy lắp ráp trong nước.  - Phụ tùng xe máy và mạng lưới đại lý bán hàng và  ... đẳng cấp tiềm kinh tế người sử dụng  Thị trường xe tay ga có cạnh tranh gay gắt hãng xe máy lớn như: Honda, Yamaha, SYM, Suzuky,… Lịch sử công ty Yamaha Tại Việt Nam Trên giới  Thành lập từ ngày...
  • 12
  • 711
  • 2

Bài thuyết trình: Xuất khẩu cá tra cá basa của Việt Nam sang thị trường Mỹ

Bài thuyết trình: Xuất khẩu cá tra và cá basa của Việt Nam sang thị trường Mỹ
... dung Nuôi tra basa Đồng sông Cửu Long, chế biến đông lạnh xuất sang Mỹ Nghề nuôi da trơn thị trường da trơn Mỹ Cuộc chiến tên gọi ‘catfish’ Vụ kiện bán phá giá Nuôi tra basa Đồng ... năm 2001 Các chủ trại nuôi catfish ‘cáo buộc’ sản phẩm tra basa nhập từ Việt Nam nguyên nhân gây giảm sút Cuộc chiến tên gọi catfish Lập luận CFA tra basa Việt Nam catfish catfish ... lượng xuất tra basa đông lạnh sang Mỹ có giảm doanh nghiệp chế biến thủy sản Việt Nam phải in lại thay nhãn hiệu nên phải tạm ngưng xuất hàng sang Mỹ Vụ tranh chấp tên gọi làm cho tra basa trở...
  • 23
  • 571
  • 8

Tài liệu Bài thuyết trình: Khái niệm Tín Hiệu Hệ Thống doc

Tài liệu Bài thuyết trình: Khái niệm Tín Hiệu và Hệ Thống doc
... liên hệ với hệ thống khác trao đổi thông tin I.2 :Hệ thống Hệ thống tín hiệu vào tín hiệu ra: hệ đơn tín hiệu (single input single output system, gọi tắt hệ đơn)  Hệ thống nhiều tín hiệu vào ... thống  Phân loại theo tín hiệu Hệ thống điều khiển tín hiệu liên tục  Hệ thống điều khiển tín hiệu số III.2: Phân loại hệ thống Hệ thống tuyến tính : Là hệ thống miêu tả hệ phương trình vi ... nhiều tín hiệu : hệ thống đa tín hiệu vào đa tín hiệu ra, gọi tắt hệ đa tín hiệu hệ MIMO (multi-input multioutput system, gọi tắt hệ đa) II: Các đặc trưng tín hiệu phân loại II.1: Các đặc trưng tín...
  • 36
  • 387
  • 9

Tài liệu Bài thuyết trình: Dung sai hình dạng vị trí pptx

Tài liệu Bài thuyết trình: Dung sai hình dạng và vị trí pptx
... thẳng:  Dung sai độ trụ:  Dung sai độ tròn: Các kí hiệu dạng sai lệch:  Dung sai profin mặt cắt dọc:  Dung sai độ song song:  Dung sai độ vuông góc:  Dung sai độ đồng tâm:  Dung sai độ đối ...  Dung sai hình dạng biểu diễn hai ô hình chữ nhật Ô thứnhất ghi ký hiệu dạng sai lệch, ô thứ hai ghi giá trị sai lệch lớn cho phép: Các kí hiệu dạng sai lệch:  Dung sai độ phẳng:  Dung sai ... hiệu dạng sai lệch:  Dung sai độ giao nhau:  Dung sai độ đảo hướng kính:  Dung sai độ đảo mặt mút: Các kí hiệu dạng sai lệch: 10 Các kí hiệu dạng sai lệch: 11 Một số ví dụ ghi kí hiệu sai lệch...
  • 15
  • 492
  • 6

Tài liệu Bài thuyết trình quản trị " Vai trò chức năng của nhà của nhà quản trị" pptx

Tài liệu Bài thuyết trình quản trị
... ĐÍCH TRÌNH BÀY Thế tổ chức? thuyết quản trị gì?, phải học QT? Hiểu quản trị gì? Giải thích nhà quản trị làm gì? Tầm quan trọng nhà quản trị gì? Nhà quản trị chức gì? Ứng dụng lý thuyết quản ... bình VAI TRỊ CỦA NHÀ QUẢN TRỊ (tt) Vai trò nhà quản trị (Henry mintzberg-1973): Vai trò nhà quản trị Mintzberg Quan hệ với người Quyết định Thơng tin LĨNH VỰC QUAN HỆ VỚI CON NGƯỜI VAI TRỊ TÌNH ... định GIỚI THIỆU CHUNG (tt) - Các kỹ nhà quản trị: Kỹ nhận thực tư Quản trị cấp cao Quản trị cấp trung Quản trị cấp sở Kỹ nhân Kỹ kỹ thuật VAI TRỊ CỦA NHÀ QUẢN TRỊ Sử dụng cách hiệu nguồn lực đạt...
  • 28
  • 601
  • 5

Nghiên cứu xây dựng quy trình phát hiện nhanh virus cúm gia cầm a h5n1 trong mẫu bệnh phẩm bằng kỹ thuật multiplex reverse transcription polymerase chain reaction

Nghiên cứu xây dựng quy trình phát hiện nhanh virus cúm gia cầm a h5n1 trong mẫu bệnh phẩm bằng kỹ thuật multiplex reverse transcription polymerase chain reaction
... GTGACAGGATTGGTCTTGTCTT 158-139 55.8 DiagH5F AGTGATCAGATTTGCATTGGTTAC 46-69 54.6 DiagH5R GACCAAGAACTTTTGGGGATG 416-396 55.4 DiagN1F CCAGTTGGTTGACAATTGGAAT 503-524 54.5 DiagN1R GCATCAGGATAACAGGAGCA ... Influenza, 12th edn Ames, IA: Blackwell Publishing Professional 46 Takano R, Nidom CA, Kiso M, Muramoto Y, Yamada S, Sakai-Tagawa Y, Macken C, Kawaoka Y (2009), “Phylogenetic characterization of H5N1 ... H5 and H7 avian influenza viruses: amino acid sequence at the HA cleavage site as a marker of pathogenicity potential”, Avian Diseases, 40: 425437 45 Swayne DE and Halverson DA (2007), Diseases...
  • 11
  • 189
  • 0

Bài thuyết trình " Định vị thị trường các bước trong tiến trình định vị" doc

Bài thuyết trình
... không, tùy thuộc vào “sự thể hiện” sản phẩm Các bước tiến trình đinh vị Định vị thị trường phải trải qua bước sau: • Bước 1: Tiến hành phân đoạn thị trường, lựa chọn đoạn thị trường mục tiêu ... Marketing • Bước 2: Vẽ biểu đồ định vị, đánh giá thực trạng định vị thị trường mục tiêu xác định vị cho sản phẩm / doanh nghiệp biểu đồ • Bước 3: Xây dựng phương án định vị Bước 4: Soạn ... người khác?”, “lý để tin vào điều đó?” Thị trường gì? • Nơi tiêu thụ hàng hóa Thế định vị thị trường? Định vị thị trường thiết kế sản phẩm hình ảnh doanh nghiệp nhằm chiếm vị trí đặc biệt có giá...
  • 11
  • 374
  • 0

Xem thêm

Từ khóa: bai thuyet trinh tinh trang san xuat va phat trien cay che o vung tay bacbài thuyết trình đường lối xây dựng và phát triển nền văn hoáthực hiện quy trình tín dụng nhanh chóng và hiệu quảthuyết trình phát hiện và giải quyết vấn đềbài thuyết trình phát triển phần mềmbài thuyết trình văn hóa giao tiếp và kinh doanh của nước ngabài thuyết trình hay về phòng chống tội phạmbai thuyet trinh ve quy tien te va ngan hang the gioichiến lược phát triển đô thị đối mặt với những thách thức về đô thị hóa nhanh chóng và chuyển đổi sang nền kinh tế thị trườngquá trình phát hiện tri thức và khai phá dữ liệuquản lý chính sách kinh tế vĩ mô hợp lý là hết sức cần thiết cho sự phát triển nhanh chóng và bền vữngcách giảm cân nhanh chóng và hiệu quả cho namtài liệu bài thuyết trình môn kinh tế vi mô chuyên đề phân tích thị trường doctổ bốc vác công ty có đội ngũ nhân công bốc xếp hàng hóa chuyên nghiệp công ty luôn mong muốn đáp ứng tốt nhu cầu bốc xếp an toàn nhanh chóng và tiện lợi cho quý khách hànggóp phần vào quá trình phát triển công nghệ và chuyển dịch cơ cấu kinh tế theo hướng cnh hđhCAC CHUYEN DE BD HSG hanoi hn 2012TAI LIEU0TAP HUAN CHUYEN TOAN 2012TRUONGHE TOANROIRACVAMOTSOVANDELIENQUANCái cười của thánh nhân - Thu Giang Nguyễn Duy CầnChia tay ý thức hệ - Hà Sỹ PhuCộng đồng người Thượng trên cao nguyên miền Trung - Nguyễn Văn HuyTRUONGHE UNGDUNGCUAGIAITICHchuyen de song co chi tiet hayĐọc và Suy Nghĩ - Trần Xuân Hải dịchHuyền thoại TTKH và Hai sắc hoa ty gôn - Thụy KhuêKý sự đi Tây - Đỗ KhiêmLạc Đường - Đào HiếuNGÔ THÌ NHẬM - Nguyễn Duy ChínhGiải bài tập trang 104, 105 SGK Toán 4: Luyện tập diện tích hình bình hànhRỪNG THIỀN - T.T. THÍCH NHẬT QUANGGiải bài tập trang 172 SGK Sinh lớp 6: Địa ySóng từ trường - Thụy KhuêThần thoại Hy Lạp - Nguyễn Văn KhỏaNghiên cứu xây dựng chính sách giá cước vận tải hành khách bằng đường hàng không ở việt namHoàn thiện quản lý vốn và tài sản trong các tổng công ty giao thông
Nạp tiền Tải lên
Đăng ký
Đăng nhập