Alkali and Halotolerant Catalase from Halomonas sp. SK1: Overexpression in Escherichia coli, Purification, Characterization, and Genetic Modification

Báo cáo khoa học: Stabilities and activities of the N- and C-domains of FKBP22 from a psychrotrophic bacterium overproduced in Escherichia coli pptx

Báo cáo khoa học: Stabilities and activities of the N- and C-domains of FKBP22 from a psychrotrophic bacterium overproduced in Escherichia coli pptx
... FkpA [11], these proteins are composed of N- and C-domains, which are spanned by a 40 amino acid long a3 helix The N-domain consists of a1 and a2 helices and an N-terminal region of a3 helix The ... FKBP22 variants containing either one of these domains and compare their activities and stabilities with those of the intact protein In this report, the N- and C-domains of SIB1 FKBP22 were overproduced ... suggesting that N-domain+ assumes a similar helical structure to that of the N-domain in the intact molecule On the other hand, the CD spectra of C-domain+ and C-domain– gave a broad trough with a...
  • 11
  • 132
  • 0

Tài liệu Báo cáo " synthesis, cloning and expression in escherichia coli of a gene coding for Mcoti-ii " ppt

Tài liệu Báo cáo
... gtgactgcag gaaggggatc cggctgctaa caaagcccga 280 281 aaggaagctg agttggctgc tgccaccgct gagcaataac 320 321 tagcataccc 361 TTTTTGCTGA cttggggcct AAGGAGGAAC ctaaacgggt TATATCCGGA cttgaggggt TATCCCGCAA ... taagacttttttacggcggcgctatcgctaacgggcccgcgc attctgaaaaaatgccgccgcgatagcgattgcccgggcgcg I L K K C R R D S D C P G A acgtaaacggcgccgttgccgataacgccgattgagctcggc tgcatttgccgcggcaacggctattgcggctaactcgagccg ... TATCCCGCAA 360 400 401 GAGCCCGGCA GTACCGGCAT AACCAAGCCT ATGCCTACAG 440 441 CATCCAGGGT TTG GACGGTGCCG AGGATGACGA TGAAGCGCCA 480 Fig Sequence of recombinant plasmid DNA containing TI gene fragment Expression...
  • 9
  • 197
  • 0

Tài liệu Báo cáo khoa học: Applications of diagonal chromatography for proteomewide characterization of protein modifications and activity-based analyses doc

Tài liệu Báo cáo khoa học: Applications of diagonal chromatography for proteomewide characterization of protein modifications and activity-based analyses doc
... Gevaert et al COFRADIC and protein modifications analysis of purine-binding proteins in a total lysate of human Jurkat T-cells [40] primary separation mAU 1400 COFRADIC analysis of protein processing ... [34,36] and N-glycosylation [39] – and describe the use of COFRADIC for studying interactions between small molecules and proteins The latter is a particular application of ‘post-translational COFRADIC’, ... COFRADIC and protein modifications K Gevaert et al large number of species, and it now suffices to generate partial protein sequence information with which to access entire (predicted) protein...
  • 13
  • 171
  • 0

Báo cáo khoa học: Connection of transport and sensing by UhpC, the sensor for external glucose-6-phosphate in Escherichia coli ppt

Báo cáo khoa học: Connection of transport and sensing by UhpC, the sensor for external glucose-6-phosphate in Escherichia coli ppt
... mutations of a membrane protein can in uence the efficiency of integration into the native membrane and thus in uence the apparent transport activity The efficiency of protein incorporation into the E coli ... (b) the translocation pathway in UhpC for the transport of Glc6P; (c) the ability of UhpC to interact with UhpB in the transmission of the induction signal; (d) the insertion of UhpC into the ... inducing conformation and which argues against the transport of Glc6P causing an inducing conformation For UhpC and other membrane proteins acting as sensors it has been shown that insertional...
  • 8
  • 134
  • 0

Báo cáo Y học: Overexpression of a recombinant wild-type and His-tagged Bacillus subtilis glycine oxidase in Escherichia coli pptx

Báo cáo Y học: Overexpression of a recombinant wild-type and His-tagged Bacillus subtilis glycine oxidase in Escherichia coli pptx
... that GO and DAAO oxidize D-proline, D-alanine and D-2-aminobutyrate with similar relative efficiencies Analogously, GO and MSOX show a fairly similar activity on sarcosine and N-ethylglycine In ... possesses a wide substrate specificity In addition to sarcosine and glycine, even N-ethylglycine, ethylglycine ester, D-alanine, D-2-aminobutyrate, D-proline, D-pipecolate and N-methyl-D-alanine are ... then assayed using the standard O2 consumption assay at 25 °C Data are expressed as per cent of enzyme activity in the standard assay; the lines through the data points have been obtained by smooth...
  • 8
  • 150
  • 0

Báo cáo khoa học: Esculentin-1b(1–18) – a membrane-active antimicrobial peptide that synergizes with antibiotics and modifies the expression level of a limited number of proteins in Escherichia coli doc

Báo cáo khoa học: Esculentin-1b(1–18) – a membrane-active antimicrobial peptide that synergizes with antibiotics and modifies the expression level of a limited number of proteins in Escherichia coli doc
... ¼ X A= MICA þ B=MICB Þ=n where A and B are the MICs of drug A and drug B in the combination, MICA and MICB are the MICs of drug A and drug B alone, FICA and FICB are the FICs of drug A and drug ... Brancatisano FL, Barra D, Campa M & Batoni G (2008) Comparative analysis of the bactericidal activities of amphibian peptide analogues against multidrug-resistant nosocomial bacterial strains Antimicrob ... permeation/proteome proteome of the target microorganism and no microbial resistance; and (b) the design of potential coadjuvants of those antimicrobial agents that are already available after incubation...
  • 18
  • 180
  • 0

Báo cáo khoa học: Characterization of the glutamyl endopeptidase from Staphylococcus aureus expressed in Escherichia coli pptx

Báo cáo khoa học: Characterization of the glutamyl endopeptidase from Staphylococcus aureus expressed in Escherichia coli pptx
... may induce the cascade reaction of GluV8 activation, because recombinant proteins remain inside E coli cells, instead of being secreted from S aureus The conversion of amino acids adjacent to the ... samples, the mature form of GluV8 could be renatured even after exposure to heat in the presence of SDS Role of N-terminal Val69 in processing of the GluV8 proform Finally, the role of N-terminal ... single species with the N-terminus of Ile56 (Table 1) The N-terminus of the 38 and 40 kDa forms was Val69, which coincided with the N-terminus of native GluV8 [5] Thermolysin-processed recombinant...
  • 15
  • 95
  • 0

Báo cáo khoa học: nNOS inhibition, antimicrobial and anticancer activity of the amphibian skin peptide, citropin 1.1 and synthetic modifications pot

Báo cáo khoa học: nNOS inhibition, antimicrobial and anticancer activity of the amphibian skin peptide, citropin 1.1 and synthetic modifications pot
... dahleins 1.1 and 1.2 [53] and some synthetic modifications of lesueurin The solution structure of citropin 1.1 synthetic modification (A4K14 -citropin 1.1) The solution structure of the basic peptide citropin ... into the structure /activity relationships for the amphibian peptide citropin 1.1 The activities of citropin 1.1 are compared with those of a number of synthetically modified citropins and other ... spacer peptide and the active citropin 1.1 is released onto the skin Citropin 1.1 must be cytotoxic to the frog as after about 10 of exposure on the skin a further endoprotease removes the first two...
  • 13
  • 163
  • 0

Báo cáo Y học: Oxidation of propionate to pyruvate in Escherichia coli Involvement of methylcitrate dehydratase and aconitase pot

Báo cáo Y học: Oxidation of propionate to pyruvate in Escherichia coli Involvement of methylcitrate dehydratase and aconitase pot
... reconstitution of the oxidation of propionyl-CoA to pyruvate by the use of purified PrpC, PrpD, AcnB and PrpB from E coli PrpD and AcnB involved in the conversion of methylcitrate into 2-methylisocitrate ... methylcitrate into 2-methylisocitrate PrpD is involved in the dehydration of (2S,3S) -methylcitrate to 2-methyl-cisaconitate The elimination of water from (2S,3S) -methylcitrate to 2-methyl-cis-aconitate ... enterica enzymes: 2 -methylcitrate dehydratase (PrpD) and aconitase enzymes catalyze the conversion of 2 -methylcitrate to 2-methylisocitrate Biochemistry 40, 4703–4713 12 Creighton, D.J & Murthy, N.R.S.K...
  • 11
  • 179
  • 0

Báo cáo Y học: DNA supercoiling in Escherichia coli is under tight and subtle homeostatic control, involving gene-expression and metabolic regulation of both topoisomerase I and DNA gyrase docx

Báo cáo Y học: DNA supercoiling in Escherichia coli is under tight and subtle homeostatic control, involving gene-expression and metabolic regulation of both topoisomerase I and DNA gyrase docx
... topoisomerase I is activated or DNA gyrase is inhibited to compromise DNA, and equal to: Hsupercoiling v ˆ kt v kt topoisomerase topoisomerase gyrase gyrase esupercoilingI ‡ esupercoiling I À esupercoiling ... esupercoiling À v kt v kt topoisomerase topoisomerase gyrase gyrase esupercoilingI ‡ esupercoiling I À esupercoiling À esupercoiling …4† The elasticities of gyrase activity and gyrase expression ... ttopoisomerase I OsupercoilingI etopoisomerase ˆ ˆ Ctsupercoiling topoisomerase I e topoisomerase Cttopoisomerase II v kt v topoisomerase gyrase gyrase esupercoilingI À esupercoiling À esupercoiling …5†...
  • 8
  • 172
  • 0

Báo cáo Y học: Extra terminal residues have a profound effect on the folding and solubility of a Plasmodium falciparum sexual stage-specific protein over-expressed in Escherichia coli pptx

Báo cáo Y học: Extra terminal residues have a profound effect on the folding and solubility of a Plasmodium falciparum sexual stage-specific protein over-expressed in Escherichia coli pptx
  • 5
  • 158
  • 0

Báo cáo Y học: Puri®cation and characterization of the human adenosine A2a receptor functionally expressed in Escherichia coli doc

Báo cáo Y học: Puri®cation and characterization of the human adenosine A2a receptor functionally expressed in Escherichia coli doc
... theophylline The arrow points to the M-A2aTr316-H10 fusion protein Note that the main contamination, seen in lane 1, runs only marginally above the hA2aR fusion protein and is the main band in ... obtained, namely LysIle-Glu-Glu-Gly-Lys-Leu-Val-Ile-Trp corresponds to the N-terminus of the mature maltose-binding protein Binding of the fusion protein to the IMAC gel in buffer containing ... solubilization and puri®cation of a hA2aR fusion protein in quantity and quality suf®cient for biophysical characterization and crystallization The following points made the puri®cation of large amounts of...
  • 11
  • 169
  • 0

Báo cáo khoa học: Translation initiation region dependency of translation initiation in Escherichia coli by IF1 and kasugamycin pdf

Báo cáo khoa học: Translation initiation region dependency of translation initiation in Escherichia coli by IF1 and kasugamycin pdf
... components, in contrast to the other translation initiation factors IF2 and translation initiation factor [22] IF1 contains an oligomer-binding motif with high homology to the RNA-binding domains of ribosomal ... common denominator for cspA and infA The compensation of the cold sensitivity of IF1 mutant strains by the inactivation of cspA is another functional link to IF1 In view of the finding that IF1 has ... 277, 225–230 Stringer EA, Sarkar P & Maitra U (1977) Function of initiation factor in the binding and release of initiation factor from ribosomal initiation complexes in Escherichia coli J Biol Chem...
  • 12
  • 191
  • 0

Báo cáo khoa học: Purification and functional characterization of human 11b hydroxylase expressed in Escherichia coli doc

Báo cáo khoa học: Purification and functional characterization of human 11b hydroxylase expressed in Escherichia coli doc
... volume and energetic properties of the binding of CO to hemoproteins Biophys J 66, 89–98 Tuckey RC & Kamin H (1983) Kinetics of O2 and CO Binding to adrenal cytochrome P-450scc Effect of cholesterol, ... was in the range of values determined in previous studies for the interaction between bovine Adx and bCYP11B1 Biacore measurements were performed to investigate the binding behavior between bovine ... the functional and structural consequences of two point mutations (P94L and A368D) in the CYP11B1 gene causing congenital adrenal hyperplasia resulting from 11 -hydroxylase deficiency J Clin Endocrin...
  • 12
  • 140
  • 0

Báo cáo khoa học: Coexpression, purification and characterization of the E and S subunits of coenzyme B12 and B6 dependent Clostridium sticklandii D-ornithine aminomutase in Escherichia coli potx

Báo cáo khoa học: Coexpression, purification and characterization of the E and S subunits of coenzyme B12 and B6 dependent Clostridium sticklandii D-ornithine aminomutase in Escherichia coli potx
... sequence of oraE to those of known PLPdependent aminomutases reveals the presence of a conserved PLP-binding site, a lysine residue at position 629, at the C-terminus of the OraE protein [11] The binding ... alone, OraS protein can be expressed in a soluble form However, the OraE and OraS proteins were coexpressed in an Fig The over-expression of oraS and oraE at different temperatures (A) Supernatant ... folding of the desired expressed protein can be improved at lower induction temperatures [8–10] As shown in Fig 1, the solubility of the overexpressed OraS and OraE increases with decreasing IPTG induction...
  • 5
  • 192
  • 0

Xem thêm

Từ khóa: Đề, đáp án vật lí 9 chọn đội tuyển thi tỉnh vòng 2 2016 2017 ngọcBản sắc dân tộc Nga trong truyện ngắn A.ChekhovBiện pháp quản lý hoạt động tạo hình cho trẻ mầm non trong trường mầm non Ánh Sao, quận Long Biên - Hà NộiCustomer Behavior, Emotional Labour, and Employee’s Emotional Outcome in Hotel Industry in Thai Nguyen Province (2)Các yếu tố ảnh hưởng tới sự hài lòng của các nhà đầu tư vào các khu công nghiệp của tỉnh Thái Nguyên (1)Đánh giá tác động của sự chuyển đổi đất nông nghiệp sang đất phi nông nghiệp trong quá trình đô thị hóa tại các đô thị vệ tinh của thành phố Huế, tỉnh Thừa Thiên HuếPhát triển công nghiệp làng nghề vùng đồng bằng Sông Hồng (1)Đề tài chiến tranh trong trường ca Trần Anh TháiHỗn độn của Nguyễn Khắc Phục từ góc nhìn tự sự họcNâng cao chất lượng dịch vụ du lịch tàu biển tại Nha Trang, Khánh HòaNghiên cứu sự tham gia của cộng đồng vào hoạt động du lịch tại huyện đảo Phú Quý, tỉnh Bình ThuậnNhân vật trong truyện ngắn Nguyễn Ngọc Tưtrắc nghiệm hàm số, logarit có đáp ánôn thi tiếng anh 12Đánh giá năng lực quản lý các lớp chuyên viên chính của Học viện Hành chính Quốc gia dưới góc nhìn học viênĐề thi tiếng nhật JTEST AD 96Đề thi tiếng nhật JTEST AD 97Phương pháp đo độ phẳngskkn một số giải pháp ứng dụng hiệu quả hệ thống phần mềm VEMIS ở trường THPT triệu sơnChính sách công nghệ xử lý xung đột môi trường giữa bệnh viện và cộng đồng dân cư sống xung quanh (Nghiên cứu trường hợp Bệnh viện Bạch Mai)
Nạp tiền Tải lên
Đăng ký
Đăng nhập