Amyloid assemblies of influenza a virus PB1 f2 protein damage membrane and induce cytotoxicity pdf

Báo cáo hóa học: " A broad spectrum, one-step reverse-transcription PCR amplification of the neuraminidase gene from multiple subtypes of influenza A virus" pdf

Báo cáo hóa học:
... samples from allantoic from all NA One-step RT -PCR amplification of NA gene from all NA subtypes using animal samples from allantoic fluids A fragment of approximately 253 bp was amplified using ... representation of 3,337 available sequences in the NCBI database at the time the study was conducted All NA subtypes were aligned against the NA10R primer and analyzed for discrepancies at the 3'end The ... [32-34] The percentage of samples with identical matches at all five 3' terminal bases was calculated for each NA subtype Figure NPA samples One-step RT -PCR amplification of NA gene from clinical One-step...
  • 11
  • 143
  • 0

Báo cáo y học: " Analysis of the PDZ binding specificities of Influenza A Virus NS1 proteins" ppt

Báo cáo y học:
... to analyse any differences between the PDZ- binding activities of the human and avian NS1 proteins A PDZ array assay had previously been reported, using a large number of isolated PDZ domains, and ... Human (H) NS1, together with the non -PDZ- binding mutant of Avian NS1 (Aa), plus the avian human-like (Ah) and the human avian-like (Ha) mutants Lower panel GST pulldown assay using these NS1 ... mutant of Avian NS1 (Aa) B GST-pulldown assay, using the NS1 proteins shown in panel A C Histogram showing the collated results of at least such assays Mapping the the PDZ domain of Dlg targeted...
  • 9
  • 155
  • 0

Báo cáo y học: "Conserved epitopes of influenza A virus inducing protective immunity and their prospects for universal vaccine development" doc

Báo cáo y học:
... only against linear epitopes but also against conformational epitopes Above described results indicate that eM2 is a valid and versatile vaccine candidate to induce protective immunity against any ... G, Ali M, Wan H, Murakami A, Yammanuru A, Han T, Cox NJ, Bankston LA, Donis RO, Liddington RC, Marasco WA: Structural and functional bases for broad-spectrum neutralization of avian and human influenza ... supertypes: a revised and update classification BMC Immunol 2008, 9:1 120 Matsui M, Kohyama S, Suda T, Yokoyama S, Mori M, Kobayashi A, Taneichi M, Uchida T: A CTL-based liposomal vaccine capable of...
  • 13
  • 106
  • 0

Báo cáo y học: "Isolation of mixed subtypes of influenza A virus from a bald eagle (Haliaeetus leucocephalus)" pptx

Báo cáo y học:
... New York 1987 doi:10.1186/1743-422X-7-174 Cite this article as: Goyal et al.: Isolation of mixed subtypes of influenza A virus from a bald eagle (Haliaeetus leucocephalus) Virology Journal 2010 ... reaction Abbreviations AIV: avian influenza virus; HPAI: highly pathogenic avian influenza virus; LPAI: low pathogenic avian influenza virus; NIH: National Institutes of Health; rRT- Authors’ contributions ... Fabbi M, Moreno A, Sala G, Lavazza A, Ghelfi E, Pirovano G, Gasperi E: Avian influenza virus (H7 serotype) in a saker falcon in Italy Vet Rec 2000, 146:740 Page of 17 De Marco MA, Foni E, Campitelli...
  • 4
  • 55
  • 0

Báo cáo khoa học: "Evolution of the M gene of the influenza A virus in different host species: large-scale sequence analysis" pdf

Báo cáo khoa học:
... The M2 protein comprises 97 amino acids – 24 in the extracellular domain, 19 in the transmembrane domain, and 54 in the cytoplasmic domain Extracellular domain of M2 is recognized by hosts' immune ... avian influenza A virus pool [1] In avian species, influenza A viruses are in an evolutionary stasis [1] In contrast, all gene segments of mammalian viruses continue to accumulate amino acid substitutions ... introduction of new HA and/or NA subtype into human population All known HA and NA subtypes are maintained in avian species, and all mammalian influenza A viruses are thought to be derived from the avian...
  • 13
  • 114
  • 0

Báo cáo y học: " Highly pathogenic avian influenza A virus H5N1 NS1 protein induces caspase-dependent apoptosis in human alveolar basal epithelial cells" docx

Báo cáo y học:
... that the NS1 protein of influenza A virus H5N1 was able to induce apoptosis in A5 49 cells Involvement of caspases in NS1- induced apoptosis B C Figure H5N1 NS1 protein induces apoptosis in A5 49 ... cell apoptosis Recently, It has been reported that avian influenza virus A/ HK/483/97 (H5N1) NS1 protein- induced apoptosis in human lung epithelial cells is mainly via the caspase-dependent pathway ... 81:3058-3067 28 Hayman A, Comely S, Lackenby A, Murphy S, McCauley J, Goodbourn S, Barclay W: Variation in the ability of human influenza A viruses to induce and inhibit the IFN-beta pathway Virology 2006,...
  • 6
  • 80
  • 0

Báo cáo sinh học: " Roles of adjuvant and route of vaccination in antibody response and protection engendered by a synthetic matrix protein 2-based influenza A virus vaccine in the mouse" pdf

Báo cáo sinh học:
... 22:477-481 Asanuma H, Aizawa C, Kurata T, Tamura S: IgA antibody- forming cell responses in the nasal-associated lymphoid tissue of mice vaccinated by intranasal, intravenous and/ or subcutaneous administration ... peptide vaccine that contains ectodomains of matrix protein Vaccine 2003, 21:2616-2626 Slepushkin VA, Katz JM, Black RA, Gamble WC, Rota PA, Cox NJ: Protection of mice against influenza A virus challenge ... long lasting resistance against IAV infection, independent of the glycoprotein makeup of circulating IAV strains The ectodomain of matrix protein (M2e) is a promising candidate for a broadly protective...
  • 14
  • 232
  • 0

Báo cáo hóa học: " Roles of adjuvant and route of vaccination in antibody response and protection engendered by a synthetic matrix protein 2-based influenza A virus vaccine in the mouse" doc

Báo cáo hóa học:
... 22:477-481 Asanuma H, Aizawa C, Kurata T, Tamura S: IgA antibody- forming cell responses in the nasal-associated lymphoid tissue of mice vaccinated by intranasal, intravenous and/ or subcutaneous administration ... peptide vaccine that contains ectodomains of matrix protein Vaccine 2003, 21:2616-2626 Slepushkin VA, Katz JM, Black RA, Gamble WC, Rota PA, Cox NJ: Protection of mice against influenza A virus challenge ... long lasting resistance against IAV infection, independent of the glycoprotein makeup of circulating IAV strains The ectodomain of matrix protein (M2e) is a promising candidate for a broadly protective...
  • 14
  • 140
  • 0

Báo cáo hóa học: " In vitro inhibition of human influenza A virus replication by chloroquine" pot

Báo cáo hóa học:
... demonstrates an inhibitory effect against the replication of human influenza A virus H1N1 and H3N2, in vitro and further studies to explore its therapeutic and prophylactic potential against influenza ... respectively Only a handful of drugs are able to inhibit influenza A virus replication and the increasing prevalence of resistance to these drugs demands newer classes of anti -influenza drugs Although ... treat- ment of influenza A (H5N1) infection since the pathology of avian influenza infection in humans appears to be mediated by pro-inflammatory cytokines...
  • 3
  • 141
  • 0

Báo cáo hóa học: " Temperature sensitive influenza A virus genome replication results from low thermal stability of polymerase-cRNA complexes" doc

Báo cáo hóa học:
... polymerase leads to the synthesis of run-off transcripts with the sequence: AGUAGAAACAAGGGUGUUUUUUCCCGGGAAUUCGGAUCCACACCCUGCUUUUG CUand AGCAAAAGCAGGGUGUGUGGAUCCGAAUUCCCGGGUAAAAAACACCCUUGUUUCUACU, ... that replication of influenza virus is regulated by stabilization of replicative intermediates J Virol 2004, 78:9568-9572 Nakagawa Y, Oda K, Nakada S: The PB1 subunit alone can catalyze cRNA ... ratios of cRNA to mRNA and vRNA to mRNA changed by around fold across the temperature range When a cRNA-like CAT RNA was transfected the cRNA:mRNA ratio decreased by over 3-fold and the vRNA:mRNA...
  • 16
  • 196
  • 0

Báo cáo khoa học: " A real-time RT-PCR for detection of clade 1 and 2 H5N1 Influenza A virus using Locked Nucleic Acid (LNA) TaqMan probes" pps

Báo cáo khoa học:
... clade 2. 3, and 92% for clade 2 .1 (Table 1) Table H5N1 clinical samples and rRT-PCR results Samples /virus clade NS TS TA Plas PF Stool Total 0 10 rRT-PCR positive Clade 10 Clade 2 .1 17 0 25 23 Clade ... potentially pandemic H5N1 influenza virus in eastern Asia Nature 20 04, 430(6996) :20 9- 21 3 WHO: Evolution of H5N1 avian influenza viruses in Asia Emerg Infect Dis 20 05, 11 (10 ) :15 15 -15 21 Smith GJ, Naipospos ... detection of clade and H5N1 Influenza A virus using Locked Nucleic Acid (LNA) TaqMan probes Virology Journal 2 010 7:46 Page of Submit your next manuscript to BioMed Central and take full advantage of: ...
  • 5
  • 237
  • 0

Báo cáo khoa học:" Evolution of the M gene of the influenza A virus in different host species: large-scale sequence analysis" pptx

Báo cáo khoa học:
... The M2 protein comprises 97 amino acids – 24 in the extracellular domain, 19 in the transmembrane domain, and 54 in the cytoplasmic domain Extracellular domain of M2 is recognized by hosts' immune ... avian influenza A virus pool [1] In avian species, influenza A viruses are in an evolutionary stasis [1] In contrast, all gene segments of mammalian viruses continue to accumulate amino acid substitutions ... introduction of new HA and/or NA subtype into human population All known HA and NA subtypes are maintained in avian species, and all mammalian influenza A viruses are thought to be derived from the avian...
  • 13
  • 90
  • 0

Báo cáo y học: "The role of RNA folding free energy in the evolution of the polymerase genes of the influenza A virus" potx

Báo cáo y học:
... only one of them was used in the analysis As we explained above, the choice of focusing on the ORF was dictated by the fact that the majority of the sequences in the database contain partial ... independent of the concurrent amino acid changes in the polymerase and NP genes, and independent of the codon usage bias In addition, human influenza A strains have increasingly higher folding energies ... necessarily in the 1957 pandemic) was of avian origin The possibility of an avian influenza A virus strain crossing the host barrier and successfully propagating in humans has been controversial...
  • 10
  • 161
  • 0

The role of matrix metalloproteinases (MMP) and their inhibitor in influenza a virus induced host lung injury

The role of matrix metalloproteinases (MMP) and their inhibitor in influenza a virus induced host lung injury
... disruption of the capillary-alveolar barrier function results in the leakage of inflammatory exudates, edema fluid and plasma proteins into the lung interstitium and alveolar spaces and the collapse of ... et al, 2010) 2.5 Influenza virus and host defences During an acute influenza virus infection, both arms of immunity: Innate and adaptive, are important in protecting the host against the pathogen ... pathogen The former has a primary goal of limiting virus growth and activating the onset of the adaptive arm, in which viral clearance takes place (Tate et al, 2008) In the early innate phase of host...
  • 181
  • 107
  • 0

Báo cáo hóa học: " Prevalence of Influenza A viruses in wild migratory birds in Alaska: Patterns of variation in detection at a crossroads of intercontinental flyways" potx

Báo cáo hóa học:
... Figure Geographical location of sampling sites in Alaska in 2006 and 2007 Geographical location of sampling sites in Alaska in 2006 and 2007 Hunter-harvest sampling locations are noted in red Live ... viruses in the context of sources of variation in prevalence and future sampling designs for monitoring and detection of avian influenza viruses Results Avian influenza prevalence overview Samples ... juveniles For many species of waterfowl, males not incubate eggs or rear offspring Males of species that exhibit a sexual bias in AI prevalence rate might utilize a wider range of habitats and different...
  • 10
  • 190
  • 0

Xem thêm

Từ khóa: structure function for influenza a virus neg8 polypeptideinfluence of the a b stoichiometry on defect structure sintering and microstructure in undoped and cu doped knnthe basics of finance an introduction to financial markets business finance and portfolio management pdfa practical guide to linux commands editors and shell programming pdfa practical guide to linux commands editors and shell programming pdf downloada guide to the differences between british and american english pdfa promising therapeutic target for alzheimer disease and related disorders pdfat the core of a virusa the geographic distribution of domestic animal cases of west nile virus in the united statesisolation of yellow fever virus a requisite step towards a defined vaccinea history of influenza vaccinesđặc điểm của virus gây bệnhexperience of learning a foreign languageyou learned the process of designing a business solutiona snapshot of kds a knowledgeSoạn bài Khóc Dương KhuêTỔNG HỢP TỪ VỰNG TIẾNG ANH CHUYÊN NGÀNH KINH TẾTỰ HỌC TIẾNG ANH VĂN PHÒNG VÀ GIAO TIẾP KINH TẾTỪ VỰNG TIẾNG ANH CHUYÊN NGÀNH KINH TẾ P1TÌNH HUỐNG LÊN LỊCH CUỘC HỌP TRONG HỘI THOẠI TIẾNG ANH KINH TẾTrọn bộ File Autocad Hồ sơ thiết kế nhà 9x16,6m“Giải pháp nâng cao hiệu quả sản xuất kinh doanh của công ty cổ phần đầu tư phát triển xây dựng đa lộchành vi sức khỏe dưới góc nhìn xã hộiLời bài hát Vui đến trườngThiết kế vi mạch cmos vlsi tập 3 tin học và đời sống tống văn on (chủ biên)Lời bài hát Khúc hát dạo chơiLời bài hát sinh nhật hồngLời bài hát Tay thơm tay ngoanLời bài hát chiếc đèn ông saoLời bài hát Em đi chơi thuyềnLời bài hát Em đi trong tươi xanhĐề cương thực tập thuốc mỡ thuốc đạn hỗn dịch, bào chế 2 đh y dược TPHCMdự phòng và tham vấn di truyềnLời bài hát Trường emLời bài hát Bóng dáng một ngôi trường
Nạp tiền Tải lên
Đăng ký
Đăng nhập