Báo cáo y học: " A novel approach for prediction of tacrolimus blood concentration in liver transplantation patients in the intensive care unit through support vector regression" doc

Báo cáo y học:
... used instead of 15 and 16 variables by the linear methods Apparently, these input variables contained more information in a nonlinear way than the other 15 or 16 contained in a linear way When a ... relevant input variables Background Hospital information systems in intensive care medicine generate large datasets on a daily basis These rapidly increasing amounts of data make the task of extracting ... doses of tacrolimus, namely the dose at a. m and p.m from the three days (day 1, day 2, and day 3) before the day of the measured tacrolimus blood concentration (day 0) Coadministered medications...
  • 7
  • 161
  • 0

a decentralized approach for implementing identity management in cloud computing

a decentralized approach for implementing identity management in cloud computing
... 2011, Article No 32, pp - [4] P Angin, B Bhargava, R Ranchal, N Singh, L B Othmane, L Lilien, and M Linderman, “An Entity-Centric Approach for Privacy and Identity Management in Cloud Computing, ” ... selection approach with the data mining technique and the machine learning technique Figure decentralized IdM in cloud computing C Problem area As demonstrated in [5], current approaches to IdM are ... for IdM, Privacy and Identity Management for Europe (PRIME), Windows CardSpace, and OpenID Also they propose an entity-centric approach for IdM in the cloud that based on active bundles and anonymous...
  • 7
  • 277
  • 0

Báo cáo hóa học: " ZSBT: A Novel Algorithm for Tracing DoS Attackers in MANETs" pot

Báo cáo hóa học:
... ZSBT ALGORITHM FOR MANETS Differences between Internet and MANET when tracing a DoS attacker To trace a remote DoS attacker in MANET is an extremely challenging task Two main reasons are as the ... proposed a small worldbased attacker traceback (SWAT) approach to trace DoS attacker in MANET They use traffic patterns matching (TPM) and traffic volume matching (TVM) as matching -in- depth techniques ... onto a special ICMP packet, add information about the adjacent upstream and/or downstream routers, and send it towards the same destination as the original packet The victim of an attack can then...
  • 9
  • 290
  • 0

Báo cáo y học: "A statistical approach for detecting genomic aberrations in heterogeneous tumor samples from single nucleotide polymorphism genotyping data" pot

Báo cáo y học:
... as: Yau et al.: A statistical approach for detecting genomic aberrations in heterogeneous tumor samples from single nucleotide polymorphism genotyping data Genome Biology 2010 11:R92 Submit your ... Biegel JA, Maris JM: Genomic copy number determination in cancer cells from single nucleotide polymorphism microarrays based on quantitative genotyping corrected for aneuploidy Genome Res 2009, ... S: Highly sensitive method for genomewide detection of allelic composition in nonpaired, primary tumor specimens by use of affymetrix single- nucleotide- polymorphism genotyping microarrays Am J...
  • 15
  • 359
  • 0

Báo cáo y học: " Systems biology coupled with label-free high-throughput detection as a novel approach for diagnosis of chronic obstructive pulmonary disease" pptx

Báo cáo y học:
... 12(4):314-325 114 Higashimoto Y, Yamagata Y, Taya S, Iwata T, Okada M, Ishiguchi T, Sato H, Itoh H: Systemic inflammation in chronic obstructive pulmonary disease and asthma: Similarities and differences ... molecular fingerprint is analysed, would increase the accuracy of disease diagnosis, aid earlier disease detection, allow for improved clarification of disease subtypes and allow automation for ... methods for diagnosing COPD rely on spirometry combined with the use of questionnaires and other arbitrary measures for disease classification Adopting a systems biology approach, whereby a disease...
  • 17
  • 201
  • 0

Báo cáo y học: "A novel approach to identifying regulatory motifs in distantly related genomes" pps

Báo cáo y học:
... the intergenic sequences Results A two-step procedure for phylogenetic footprinting In this study, we aimed to detect regulatory motifs that have been retained over long periods in evolution; in ... broken up into small conserved parts interrupted by gaps when aligned to the longer Fugu sequence, resulting in an incorrect alignment of the regulatory motifs: previously reported motifs were ... intergenic regions in the scl dataset (Table 6) are in the same order of magnitude (ranging from 16.5 to 40 kb), MAVID did not succeed in identifying any of the motifs previously described by...
  • 18
  • 166
  • 0

optimization of protein and rna detection methodologies and a new approach for manipulating protein activity in living cells

optimization of protein and rna detection methodologies and a new approach for manipulating protein activity in living cells
  • 144
  • 73
  • 0

Báo cáo khoa học: A new approach for distinguishing cathepsin E and D activity in antigen-processing organelles pdf

Báo cáo khoa học: A new approach for distinguishing cathepsin E and D activity in antigen-processing organelles pdf
... CatD (10 ng) Values are mean ± SD, n ¼ (Insertion: 10 ng CatE and CatD and ng antigenic peptide were incubated on an ELISA plate CatE and CatD antibodies were used for the detection at dilutions ... ⁄ well) Monospesific antibodies were preincubated with different concentrations of CatE or CatD, before standard ELISA ELISA was performed as described in Experimental procedures The increasing ... distinguishes between the activities of the enzymatically similar proteinases, CatE and CatD, and can therefore be used to investigate the involvement of these enzymes in antigen processing and...
  • 12
  • 317
  • 0

Ruta 6 selectively induces cell death in brain cancer cells but proliferation in normal peripheral blood lymphocytes: A novel treatment for human brain cancer doc

Ruta 6 selectively induces cell death in brain cancer cells but proliferation in normal peripheral blood lymphocytes: A novel treatment for human brain cancer doc
... culture PATHAK et al: RUTA 6: A NOVEL TREATMENT FOR HUMAN BRAIN CANCER 978 Figure Histograms showing percentages of mitotic index (MI) and normal and abnormal metaphases of human brain cancer and B-lymphoid ... by a G1 DNA content of 40.8% 980 PATHAK et al: RUTA 6: A NOVEL TREATMENT FOR HUMAN BRAIN CANCER Figure FISH preparations of interphase cells from a human B-lymphoid cell line and MGR1 brain cancer ... that Ruta induces death- signaling pathways in human glioma brain cancer cells, both in vivo and in vitro, and survival-signaling pathways in normal B and T lymphocytes Discussion Figure FACS analyses...
  • 8
  • 327
  • 0

Báo cáo khoa học: A novel factor XI missense mutation (Val371Ile) in the activation loop is responsible for a case of mild type II factor XI deficiency doc

Báo cáo khoa học: A novel factor XI missense mutation (Val371Ile) in the activation loop is responsible for a case of mild type II factor XI deficiency doc
... binding of the C-terminal domain of hirudin and amidase activity in human alpha-thrombin Biochem J 289, 475480 Baglia FA & Walsh PN (1996) A binding site for thrombin in the apple domain of factor ... coagulation factor XI deciency in six Italian patients Haematologica 89, 13321340 Naito K & Fujikawa K (1991) Activation of human blood coagulation factor XI independent of factor XII Factor XI ... basis of known concentration of wild -type and mutant FXIa and using the program grafit (Erithacus Software Ltd., Staines, UK) Structural analysis The structural analysis was conducted using the...
  • 11
  • 215
  • 0

Báo cáo khoa học: A novel pathway for sequential transformation of 7-dehydrocholesterol and expression of the P450scc system in mammalian skin pptx

Báo cáo khoa học: A novel pathway for sequential transformation of 7-dehydrocholesterol and expression of the P450scc system in mammalian skin pptx
... Primer location Amplified band (bp) P553 P554 P557 P558 GTGATTCTCTGCTAGATGTTG GGCACTCGAACAGTCATATTG ATTAAGGAGCTTCGGGAGATG CTCTTATACCCAATGCTGCTG First pair GCCTTTGAGTCCATCACTAAC CCAGTGTCTTGGCAGGAATC ... was and lg for placenta (lanes and 2, respectively) and 20 lg for the skin samples Side-chain cleavage of 7-DHC by placental and adrenal mitochondria Incubations were carried out as described for ... human skin, normal epidermal and immortalized keratinocytes, dermal fibroblasts, squamous cell carcinoma and five human melanomas Thus, these data clarify in detail the cutaneous expression of the...
  • 11
  • 208
  • 0

Báo cáo khoa học: "Automatic Part-of-Speech Tagging for Bengali: An Approach for Morphologically Rich Languages in a Poor Resource Scenario" pdf

Báo cáo khoa học:
... with 10K, 20K and 40K training data 3.4 Training Data The training data includes manually annotated 3625 sentences (approximately 40,000 words) for both supervised HMM and ME model A fixed set ... a reasonable POS tagger when tagged resources are limited References A Dalal, K Nagaraj, U Swant, S Shelke and P Bhattacharyya 2007 Building Feature Rich POS Tagger for Morphologically Rich Languages: ... stochastic tagging of natural language text for Bengali The models described here are very simple and efficient for automatic tagging even when the amount of available annotated text is small...
  • 4
  • 168
  • 0

báo cáo hóa học:" A practical approach for the validation of sterility, endotoxin and potency testing of bone marrow mononucleated cells used in cardiac regeneration in compliance with good manufacturing practice" docx

báo cáo hóa học:
... of the sterility testing in compliance with eu Pharmacopoeia 2.6.1 (sterility) and the validation of the potency assay in an ATMP that is constituted of bone- marrow mononucleated cells used in ... using cell systems and in vivo assays using animal models As concerning the use of bone marrow mononucleated cells in cardiac repair, the importance of characterizing the functionality of injected ... is the validation of a commercial system (Charles River Endosafe PTS) for the determination of bacterial endotoxins in compliance with Eu Pharmacopoeia 2.6.14 (bacterial endotoxins), the validation...
  • 9
  • 232
  • 0

Báo cáo hóa học: "Research Article A Decentralized Approach for Nonlinear Prediction of Time Series Data in Sensor Networks" pptx

Báo cáo hóa học:
... Quan, W J Kaiser, and A H Sayed, A spatial sampling scheme based on innovations diffusion in sensor networks,” in Proceedings of the 6th International Symposium on Information Processing in Sensor ... Shapes of the Gaussian and the Laplacian kernels around the origin more classical and universal ones In this paper, without any essential loss of generality, we are primarily interested in radial ... corresponding to a signal-to-noise ratio of 10 dB These data were used to estimate a nonlinear model, based on the Gaussian kernel, that predicts temperature as a function of location and time Preliminary...
  • 12
  • 200
  • 0

Báo cáo hóa học: " Research Article RRES: A Novel Approach to the Partitioning Problem for a Typical Subset of System Graphs" potx

Báo cáo hóa học:
... (iv) the totalised values for area Atotal , Stotal , and time Ttotal ; the time based degree of parallelism γt the ranks of all vertices; the density ρ of the system graph These values can be achieved ... hardware-software systems, Ph.D thesis, University of California, Berkeley, Calif, USA, 1995 ´ ´ [13] P Arato, Z A Mann, and A Orb´ n, “Algorithmic aspects of a hardware/software partitioning, ” ACM Transactions ... automating the system partitioning as much as possible For the last 15 years, system partitioning has been a research field starting with first approaches being rather theoretic in their nature up to quite...
  • 13
  • 84
  • 0

Xem thêm

Từ khóa: a machine learning approach for identifying diseasetreatment relations in short texts ppta machine learning approach for identifying diseasetreatment relations in short texts ieeea machine learning approach for identifying diseasetreatment relations in short texts doca machine learning approach for identifying diseasetreatment relations in short texts abstracta machine learning approach for identifying diseasetreatment relations in short texts documentationa machine learning approach for identifying diseasetreatment relations in short texts projecta machine learning approach for identifying diseasetreatment relations in short textsan old novel approach for students in biomedical systemsa novel model for global customera novel approach to semanticpivot approach for extracting paraphrase patternstowards a rulebased approach for contextaware applicationspivot approach for extracting paraphrase patterns from bilingual corporaa new approach for the morphological segmentationa new approach to the conjugacy problem in garside groupsTHỰC TRẠNG QUẢN LÝ HOẠT ĐỘNG PHỔ CẬP GIÁO DỤC BẬC TRUNG HỌC Ở HUYỆN TAM BÌNH TỈNH VĨNH LONGTHỰC TRẠNG QUẢN LÝ HOẠT ĐỘNG THƯ VIỆN Ở TRƯỜNG CAO ĐẲNG VĂN HÓA NGHỆ THUẬT VÀ DU LỊCH SÀI GÒNTừ loại trong tiếng anh vị trí danh từ vị trí tính từ vị trí trạng từEverest brochure Everest 2016 Everest 2016Vật lý đại cương hay 1Lý thuyết trò chơi là một nhánh của toán học ứng dụngVề mã constacyclic nghiệm lặp trên vành chuỗi hữu hạn (LA tiến sĩ)Lưỡng ổn định quang của buồng cộng hưởng vòng chứa môi trường trong suốt cảm ứng điện từ năm mức năng lượng (LA tiến sĩ)Nhân tố ảnh hưởng tới hiệu lực tác động của kênh lãi suất trong điều hành chính sách tiền tệ tại Việt Nam (LA tiến sĩ)ẢNH HƯỞNG của BIẾN ĐỘNG TĂNG GIÁ dầu đến TRỒNG CHÈ ở THÁI NGUYÊNTÌNH HÌNH mắc BỆNH GIUN đũa ở vật NUÔINGHIÊN CỨU PHẪU THUẬT BẮC CẦU ĐỘNG MẠCH VÀNH TRÊN BỆNH NHÂN CÓ PHÂN SUẤT TỐNG MÁU THẤT TRÁI GIẢM (LA tiến sĩ)xây dựng tính toán thiết kế trạm xử lý nướcNghiên cứu ứng dụng phương pháp lập lại lưu thông tiêu hóa tụy dạ dày trong cắt khối tá tràng đầu tụy (LA tiến sĩ)kỹ thuật sửa chữa ô tôTÌM lại IPHONE bị mấtKỹ thuật sửa chữa xe máyNghiên cứu các yếu tố chính ảnh hưởng đến độ bền đường may và mối quan hệ giữa các yếu tốNghiên cứu đánh giá chất lượng của một số loại vải thông dụng cho may mặc trên các phương diện tiện nghi, an toàn và sức khỏeNghiên cứu khảo sát đặc điểm nhân trắc học bàn chân nữ bệnh nhân tiểu đường tại thành phố hồ chí minh
Nạp tiền Tải lên
Đăng ký
Đăng nhập