Khám phá khí Oxygen

 Khám phá khí Oxygen
... Khám phá khí oxygen: Nhà hóa học Thụy Điển Carl Wilhelm Scheele (1742-1786) nghiên cứu chất khí vào năm 1768-1770, quan sát chất khí không mùi, đốt cho lửa sáng Ông cho đặc điểm "không khí ... thủy ngân đỏ Khí tỏa nghiên cứu có đặc tình quan trọng: làm hoạt động cháy, giúp hô hấp động vật Lavoisier kêu tên "khí cho sống" (air vital) Lavoisier khám phá khí hỗn hợp hai khí, air vital ... cầy cháy chất khí có độ sáng mãnh liệt " Ông diễn tả cách tỉ mỉ thí nghiệm ông cho in kết Nhân dịp bữa ăn tối, Priestley mời qua Pháp tháng 10 năm 1774 Lavoisier biết khám phá chất khí đặc biệt...
  • 7
  • 224
  • 0

Báo cáo y học: "The Influence of Hyperbaric Oxygen Treatment on the Healing of Experimental Defects Filled with Different Bone Graft Substitutes"

Báo cáo y học:
... biomaterials, different combinations of bone grafts and systemic supportive therapy alternatives are important areas of research Hyperbaric oxygen therapy (HBOT) is a mode of medical treatment in which the ... on the healing of bone lesions in different anatomical regions with ischemic perfusion, the current knowledge about its influence on bone graft substitutes used in oral reconstructive surgery ... study of the effect of hyperbaric oxygen therapy on autogenous free bone grafts J Oral Maxillofac Surg 1996; 54: 975-981 38 Chen WJ, Lai PL, Chang CH, Lee MS, Chen CH, Tai CL The effect of hyperbaric...
  • 12
  • 255
  • 0

Báo cáo y học: "Ozone Therapy and Hyperbaric Oxygen Treatment in Lung Injury in Septic Rats"

Báo cáo y học:
... proinflammatory cytokines in response to lipopolysaccharide (LPS) [6] Hyperbaric oxygen (HBO) therapy is a well established therapeutic approach increasing oxygen concentration in all tissues; improving ... the degree of lung injury in 10 fields [28] Each category was scored from to 4; then the total lung injury score was calculated by adding the individual scores for each category and the scores ... ozone therapy in experimental caustic esophageal burn J Pediatr Surg 2008;43:1679-1684 18 Uysal B, Yasar M, Ersoz N, et al Efficacy of hyperbaric oxygen therapy and medical ozone therapy in experimental...
  • 8
  • 232
  • 0

Báo cáo y học: " Helicobacter pylori induces mitochondrial DNA mutation and reactive oxygen species level in AGS cells"

Báo cáo y học:
... down-regulated both in vitro and in vivo Moreover, Hp induces genomic instability in nuclear CA repeats in mice and in mtDNA of AGS cells and chronic gastritis tissue, and this effect in mtDNA is associated ... Hp infection resulted in increased mutations in the non-coding D-loop as well as the coding genes ND1 and COI of mtDNA of gastric cells [12] The increase in the number of mutations was mainly ... mutations in the mtDNA increased and the cell viability decreased in a concentration and time dependent manner In addition, the ROS levels and Luminescence levels were not markedly changed in the...
  • 12
  • 160
  • 1


  • 12
  • 62
  • 0


... pressure in the high concentrated oxygen dissolver A valve is set at the outlet of the lab scale high concentrated oxygen dissolver By adjusting this valve, the pressure in the high concentrated oxygen ... m3/d) of high concentrated oxygen water in which the instant DO could be as high as 70 mg/L Samples were taken and pretreated in different ways to verify the effect of high concentrated oxygen water ... tons/day) of high concentrated oxygen water DO concentration in the high concentrated oxygen water achieved 10 mgO2/L Measurement of DO concentration and water temperature confirmed that the high concentrated...
  • 4
  • 160
  • 0

Tolerance Level of Dissolved Oxygen to Feed into Anaerobic Ammonium Oxidation (anammox) Reactor

Tolerance Level of Dissolved Oxygen to Feed into Anaerobic Ammonium Oxidation (anammox) Reactor
... conversion rates over time of two reactors In reactor 1, the nitrogen conversion rate had decreased from 2.9 to 1.3 kg-N/m3/d when influent DO of mg/L had been fed into reactor After that, the DO ... conversion rate was 2.3 kg-N/m3/d when DO of mg/L was fed into the reactor When DO of about mg/L, 2.5 mg/L and less than mg/L were fed into the reactors, DO concentrations in the effluent were ... concentrations of the two reactors The maximum nitrogen conversion rate of each reactor at the influent DO of about 0.2 mg/L was set to an anammox activity value of 1.0, and for the other concentrations of...
  • 10
  • 274
  • 0

Performance optimization of a PEM hydrogen-oxygen fuel cell

Performance optimization of a PEM hydrogen-oxygen fuel cell
... construct a mathematical model for investigating the performance of a PEM fuel cell at different operation variables to optimize its performance by changing some of its parameters Model validation against ... [6] K.S Dhathathreyan, P Sridhar, G Sasikumar, K.K Ghosh, G Velayutham, N Rajalakshmi, C.K Subramaniam, M Raja and K Ramya, Development of polymer electrolyte membrane fuel cell stack Int J Hydrogen ... Proton Exchange Membrane Fuel Cell Stack Fuel cells 2001;1(1):66-71 [12] J Hamelin, K Agbossou, A Laperriere and T.K Bose, Dynamic behavior of a PEM fuel cell stack for stationary applications Int...
  • 10
  • 154
  • 0

Tài liệu Báo cáo khoa học: Functional characterization of an orphan cupin protein from Burkholderia xenovorans reveals a mononuclear nonheme Fe2+-dependent oxygenase that cleaves b-diketones ppt

Tài liệu Báo cáo khoa học: Functional characterization of an orphan cupin protein from Burkholderia xenovorans reveals a mononuclear nonheme Fe2+-dependent oxygenase that cleaves b-diketones ppt
... metal–ligand distances (Table 2) compare very favorably with data in the protein database, from ˚ which an average distance of 2.03 A for Fe–N(His) was inferred [38], and a target distance of ... from genomic DNA of B xenovorans LB400 through a PCR with GAGCGGCATATGGA AATCAAACCGAAGGTTCGCGA and GAGCGGCATA TGGAAATCAAACCGAAGGTTCGCGA as the forward and reverse oligonucleotide primers, respectively ... enzymatic transformation revealed that Bxe _A2 876 catalyzed breakdown of the b-diketone substrate via oxidative carbon–carbon bond cleavage to yield methylglyoxal and acetate Kinetic characterization...
  • 15
  • 225
  • 0

Tài liệu Báo cáo khoa học: Autophagy inhibits reactive oxygen species-mediated apoptosis via activating p38-nuclear factor-kappa B survival pathways in oridonin-treated murine fibrosarcoma L929 cells doc

Tài liệu Báo cáo khoa học: Autophagy inhibits reactive oxygen species-mediated apoptosis via activating p38-nuclear factor-kappa B survival pathways in oridonin-treated murine fibrosarcoma L929 cells doc
... results indicate that oridonin induced autophagy < /b> in L929 cells Inhibition of autophagy < /b> up-regulates apoptosis < /b> in oridonin-induced L929 cells To investigate the role of autophagy < /b> in oridonininduced apoptosis < /b> ... with Beclin or LC3 siRNA also increased oridonin-induced cell apoptosis < /b> (Fig 9D) These findings demonstrate that the inhibition of autophagy < /b> increased oridonin-induced apoptosis < /b> in L929 cells FEBS ... was increased with time Autophagy < /b> inhibits < /b> ROS-mediated apoptosis < /b> in oridonin-induced L929 cells, indicating that oridonin-induced apoptosis < /b> was associated with oxidative stress Besides apoptosis,< /b> ...
  • 16
  • 178
  • 0

Tài liệu Báo cáo khoa học: Down-regulation of heme oxygenase-2 is associated with the increased expression of heme oxygenase-1 in human cell lines docx

Tài liệu Báo cáo khoa học: Down-regulation of heme oxygenase-2 is associated with the increased expression of heme oxygenase-1 in human cell lines docx
... evaluation of heme dynamics in cultured cells Role of heme metabolism in cellular heme content Regulatory role of free heme in expression of HO-1 To evaluate the contribution of heme synthesis and ... HO-1 protein was also induced by the treatment with HO-2 siRNA in HepG2 cells These results indicate that the down-regulation of HO-2 expression is associated with induction of HO-1 expression ... protein, in comparison with the low expression of HO-1 protein, in H146 small cell lung cancer cells is of particular interest because small cell lung cancer is derived from the airway neuroepithelial...
  • 14
  • 150
  • 0

Tài liệu Báo cáo khoa học: Spectroscopic characterization of a higher plant heme oxygenase isoform-1 from Glycine max (soybean) ) coordination structure of the heme complex and catabolism of heme docx

Tài liệu Báo cáo khoa học: Spectroscopic characterization of a higher plant heme oxygenase isoform-1 from Glycine max (soybean) ) coordination structure of the heme complex and catabolism of heme docx
... absorption bands of oxyheme appeared at 540 and 579 nm Then, a broad band appeared at around 660 nm, and was maximal 9–12 after initiation of the reaction The spectral features of the final reaction mixture ... modulation amplitude, 10 G for (A) and (B) and G for (C)–(E); signal acquisition temperature, K for (A) and (B) and 25 K for (C)–(E) (A) The ferric heme complex of GmHO-1 at pH 7.0 (0.1 M, KPB) a- 1, ... absorption bands Heme catabolism by HOs of mammals, pathogenic bacteria, cyanobacteria and probably insects is considered to have a similar mechanism, because the characteristic absorption bands...
  • 16
  • 190
  • 0

Tài liệu Báo cáo khoa học: Hypoxia reduces the expression of heme oxygenase-2 in various types of human cell lines A possible strategy for the maintenance of intracellular heme level pdf

Tài liệu Báo cáo khoa học: Hypoxia reduces the expression of heme oxygenase-2 in various types of human cell lines A possible strategy for the maintenance of intracellular heme level pdf
... Effects of hypoxia on HO-1 and HO-2 expression in human cell lines We initially analyzed the effects of hypoxia on the expression of HO-1 and HO-2 in human cell lines of Reduced expression of heme oxygenase-2 ... we have analyzed the effect of hypoxia on the expression levels of HO-1 and HO-2 in various types of human cell line, including erythroleukemia and hepatoma cells We have shown that hypoxia reduces ... R, Takahashi K, Takeda K, Furuyama K, Kaneko K, Takahashi S, Tamai M & Shibahara S (2004) Expression of heme oxygenase-1 is repressed by interferon-gamma and induced by hypoxia in human retinal...
  • 12
  • 219
  • 0

Tài liệu Báo cáo khoa học: Unique features of recombinant heme oxygenase of Drosophila melanogaster compared with those of other heme oxygenases studied docx

Tài liệu Báo cáo khoa học: Unique features of recombinant heme oxygenase of Drosophila melanogaster compared with those of other heme oxygenases studied docx
... a-mesocarbon of heme, leading to the exclusive a-meso-hydroxyheme formation The formation of three isomers of biliverdin by DmDHO implies that its heme pocket has a different structure from those of mammalian ... peroxide Properties of the heme DmDHO complex All HOs so far reported bind heme stoichiometrically to form stable complexes with absorption spectra resembling those of myoglobin Like other HOs, DmHO ... spectrum of the hemin–DmDHO complex exhibits a highly rhombic, highspin state of hemin, showing pronounced difference from that of the hemin complex of cyanobacterial heme oxygenase isoform-1,...
  • 12
  • 157
  • 0

Tài liệu Báo cáo khoa học: Oxygen tension regulates the expression of a group of procollagen hydroxylases docx

Tài liệu Báo cáo khoa học: Oxygen tension regulates the expression of a group of procollagen hydroxylases docx
  • 8
  • 132
  • 0

Xem thêm

Từ khóa: skkn một số biện pháp đưa rối vào trường mầm non cho trẻ 5 6 tuổi làm quen với tác phẩm văn họcSKKN một số biện pháp nhằm giảm thiểu tình trạng học sinh đọc yếu, kém ở học sinh lớp 2,3Dầu mỏ trong quan hệ Nga – EU từ năm 2000 đến nayNâng cao chất lượng chương trình du lịch Outbound LàoThái Lan tại Trung tâm lữ hành quốc tế Mê Kông, Quảng TrịYÊU CẦU CHUNG VỀ NĂNG LỰC CỦA PHÒNG THỬ NGHIỆM VÀ HIỆU CHUẨNPhim của đạo diễn Hayao Miyazaki từ góc nhìn Sinh thái học (qua ba trường hợp My neighbor Totoro, Princess Mononoke và Spirited Away)Thích ứng tâm lý của người lao động với môi trường làm việc tại doanh nghiệp FPT-ISThời gian và không gian nghệ thuật trong truyện ngắn Nguyễn Nhật ÁnhTư duy nghệ thuật trong tiểu thuyết của một số nhà văn nữ hải ngoại đương đạiBài 4 1 những kỹ thuật SEO copywritingĐề cương chi tiết học phần Vi xử lý (Đại học sư phạm kĩ thuật TP.HCM)THUYET TRINH GIỚI THIỆU VỀ PHẦN MỀM MELSHORT2PHIẾU điều TRA NÔNG hộ về THUỐC bảo vệ THỰC vậttieu luan khoa hoc cong nghe huytiểu luận nâng cao hiệu quả của công tác tuyên truyền với vấn đề bạo lực gia đình đối với người phụ nữ trong xã hội việt nam hiện nayTiểu luận văn hoá việt nam trong quá trình hội nhập quốc tế hiện nayDynaform Blank mesh sizeDynaform Boundary from surfaces in curve editorDynaform BSE training tutorial 2Dynaform Change boundary nodes number by dragging mouse