OXYGEN

Khám phá khí Oxygen

 Khám phá khí Oxygen
... Khám phá khí oxygen: Nhà hóa học Thụy Điển Carl Wilhelm Scheele (1742-1786) nghiên cứu chất khí vào năm 1768-1770, quan sát chất khí không mùi, đốt cho lửa sáng Ông cho đặc điểm "không khí ... thủy ngân đỏ Khí tỏa nghiên cứu có đặc tình quan trọng: làm hoạt động cháy, giúp hô hấp động vật Lavoisier kêu tên "khí cho sống" (air vital) Lavoisier khám phá khí hỗn hợp hai khí, air vital ... cầy cháy chất khí có độ sáng mãnh liệt " Ông diễn tả cách tỉ mỉ thí nghiệm ông cho in kết Nhân dịp bữa ăn tối, Priestley mời qua Pháp tháng 10 năm 1774 Lavoisier biết khám phá chất khí đặc biệt...
  • 7
  • 235
  • 0

Báo cáo y học: "The Influence of Hyperbaric Oxygen Treatment on the Healing of Experimental Defects Filled with Different Bone Graft Substitutes"

Báo cáo y học:
... biomaterials, different combinations of bone grafts and systemic supportive therapy alternatives are important areas of research Hyperbaric oxygen therapy (HBOT) is a mode of medical treatment in which the ... on the healing of bone lesions in different anatomical regions with ischemic perfusion, the current knowledge about its influence on bone graft substitutes used in oral reconstructive surgery ... study of the effect of hyperbaric oxygen therapy on autogenous free bone grafts J Oral Maxillofac Surg 1996; 54: 975-981 38 Chen WJ, Lai PL, Chang CH, Lee MS, Chen CH, Tai CL The effect of hyperbaric...
  • 12
  • 286
  • 0

Báo cáo y học: "Ozone Therapy and Hyperbaric Oxygen Treatment in Lung Injury in Septic Rats"

Báo cáo y học:
... proinflammatory cytokines in response to lipopolysaccharide (LPS) [6] Hyperbaric oxygen (HBO) therapy is a well established therapeutic approach increasing oxygen concentration in all tissues; improving ... the degree of lung injury in 10 fields [28] Each category was scored from to 4; then the total lung injury score was calculated by adding the individual scores for each category and the scores ... ozone therapy in experimental caustic esophageal burn J Pediatr Surg 2008;43:1679-1684 18 Uysal B, Yasar M, Ersoz N, et al Efficacy of hyperbaric oxygen therapy and medical ozone therapy in experimental...
  • 8
  • 248
  • 0

Báo cáo y học: " Helicobacter pylori induces mitochondrial DNA mutation and reactive oxygen species level in AGS cells"

Báo cáo y học:
... down-regulated both in vitro and in vivo Moreover, Hp induces genomic instability in nuclear CA repeats in mice and in mtDNA of AGS cells and chronic gastritis tissue, and this effect in mtDNA is associated ... Hp infection resulted in increased mutations in the non-coding D-loop as well as the coding genes ND1 and COI of mtDNA of gastric cells [12] The increase in the number of mutations was mainly ... mutations in the mtDNA increased and the cell viability decreased in a concentration and time dependent manner In addition, the ROS levels and Luminescence levels were not markedly changed in the...
  • 12
  • 176
  • 1

oxygen

oxygen
...
  • 12
  • 69
  • 0

NOVEL RESTORATION TECHNOLOGY FOR PUZRIFICATION OF WATER QUALITY IN CLOSED WATER BODY BY HIGH CONCENTRATED OXYGEN WATER

NOVEL RESTORATION TECHNOLOGY FOR PUZRIFICATION OF WATER QUALITY IN CLOSED WATER BODY BY HIGH CONCENTRATED OXYGEN WATER
... pressure in the high concentrated oxygen dissolver A valve is set at the outlet of the lab scale high concentrated oxygen dissolver By adjusting this valve, the pressure in the high concentrated oxygen ... m3/d) of high concentrated oxygen water in which the instant DO could be as high as 70 mg/L Samples were taken and pretreated in different ways to verify the effect of high concentrated oxygen water ... tons/day) of high concentrated oxygen water DO concentration in the high concentrated oxygen water achieved 10 mgO2/L Measurement of DO concentration and water temperature confirmed that the high concentrated...
  • 4
  • 172
  • 0

Tolerance Level of Dissolved Oxygen to Feed into Anaerobic Ammonium Oxidation (anammox) Reactor

Tolerance Level of Dissolved Oxygen to Feed into Anaerobic Ammonium Oxidation (anammox) Reactor
... conversion rates over time of two reactors In reactor 1, the nitrogen conversion rate had decreased from 2.9 to 1.3 kg-N/m3/d when influent DO of mg/L had been fed into reactor After that, the DO ... conversion rate was 2.3 kg-N/m3/d when DO of mg/L was fed into the reactor When DO of about mg/L, 2.5 mg/L and less than mg/L were fed into the reactors, DO concentrations in the effluent were ... concentrations of the two reactors The maximum nitrogen conversion rate of each reactor at the influent DO of about 0.2 mg/L was set to an anammox activity value of 1.0, and for the other concentrations of...
  • 10
  • 288
  • 0

Performance optimization of a PEM hydrogen-oxygen fuel cell

Performance optimization of a PEM hydrogen-oxygen fuel cell
... construct a mathematical model for investigating the performance of a PEM fuel cell at different operation variables to optimize its performance by changing some of its parameters Model validation against ... [6] K.S Dhathathreyan, P Sridhar, G Sasikumar, K.K Ghosh, G Velayutham, N Rajalakshmi, C.K Subramaniam, M Raja and K Ramya, Development of polymer electrolyte membrane fuel cell stack Int J Hydrogen ... Proton Exchange Membrane Fuel Cell Stack Fuel cells 2001;1(1):66-71 [12] J Hamelin, K Agbossou, A Laperriere and T.K Bose, Dynamic behavior of a PEM fuel cell stack for stationary applications Int...
  • 10
  • 167
  • 0

Tài liệu Báo cáo khoa học: Functional characterization of an orphan cupin protein from Burkholderia xenovorans reveals a mononuclear nonheme Fe2+-dependent oxygenase that cleaves b-diketones ppt

Tài liệu Báo cáo khoa học: Functional characterization of an orphan cupin protein from Burkholderia xenovorans reveals a mononuclear nonheme Fe2+-dependent oxygenase that cleaves b-diketones ppt
... metal–ligand distances (Table 2) compare very favorably with data in the protein database, from ˚ which an average distance of 2.03 A for Fe–N(His) was inferred [38], and a target distance of ... from genomic DNA of B xenovorans LB400 through a PCR with GAGCGGCATATGGA AATCAAACCGAAGGTTCGCGA and GAGCGGCATA TGGAAATCAAACCGAAGGTTCGCGA as the forward and reverse oligonucleotide primers, respectively ... enzymatic transformation revealed that Bxe _A2 876 catalyzed breakdown of the b-diketone substrate via oxidative carbon–carbon bond cleavage to yield methylglyoxal and acetate Kinetic characterization...
  • 15
  • 235
  • 0

Tài liệu Báo cáo khoa học: Autophagy inhibits reactive oxygen species-mediated apoptosis via activating p38-nuclear factor-kappa B survival pathways in oridonin-treated murine fibrosarcoma L929 cells doc

Tài liệu Báo cáo khoa học: Autophagy inhibits reactive oxygen species-mediated apoptosis via activating p38-nuclear factor-kappa B survival pathways in oridonin-treated murine fibrosarcoma L929 cells doc
... results indicate that oridonin induced autophagy < /b> in L929 cells Inhibition of autophagy < /b> up-regulates apoptosis < /b> in oridonin-induced L929 cells To investigate the role of autophagy < /b> in oridonininduced apoptosis < /b> ... with Beclin or LC3 siRNA also increased oridonin-induced cell apoptosis < /b> (Fig 9D) These findings demonstrate that the inhibition of autophagy < /b> increased oridonin-induced apoptosis < /b> in L929 cells FEBS ... was increased with time Autophagy < /b> inhibits < /b> ROS-mediated apoptosis < /b> in oridonin-induced L929 cells, indicating that oridonin-induced apoptosis < /b> was associated with oxidative stress Besides apoptosis,< /b> ...
  • 16
  • 190
  • 0

Tài liệu Báo cáo khoa học: Down-regulation of heme oxygenase-2 is associated with the increased expression of heme oxygenase-1 in human cell lines docx

Tài liệu Báo cáo khoa học: Down-regulation of heme oxygenase-2 is associated with the increased expression of heme oxygenase-1 in human cell lines docx
... evaluation of heme dynamics in cultured cells Role of heme metabolism in cellular heme content Regulatory role of free heme in expression of HO-1 To evaluate the contribution of heme synthesis and ... HO-1 protein was also induced by the treatment with HO-2 siRNA in HepG2 cells These results indicate that the down-regulation of HO-2 expression is associated with induction of HO-1 expression ... protein, in comparison with the low expression of HO-1 protein, in H146 small cell lung cancer cells is of particular interest because small cell lung cancer is derived from the airway neuroepithelial...
  • 14
  • 162
  • 0

Tài liệu Báo cáo khoa học: Spectroscopic characterization of a higher plant heme oxygenase isoform-1 from Glycine max (soybean) ) coordination structure of the heme complex and catabolism of heme docx

Tài liệu Báo cáo khoa học: Spectroscopic characterization of a higher plant heme oxygenase isoform-1 from Glycine max (soybean) ) coordination structure of the heme complex and catabolism of heme docx
... absorption bands of oxyheme appeared at 540 and 579 nm Then, a broad band appeared at around 660 nm, and was maximal 9–12 after initiation of the reaction The spectral features of the final reaction mixture ... modulation amplitude, 10 G for (A) and (B) and G for (C)–(E); signal acquisition temperature, K for (A) and (B) and 25 K for (C)–(E) (A) The ferric heme complex of GmHO-1 at pH 7.0 (0.1 M, KPB) a- 1, ... absorption bands Heme catabolism by HOs of mammals, pathogenic bacteria, cyanobacteria and probably insects is considered to have a similar mechanism, because the characteristic absorption bands...
  • 16
  • 197
  • 0

Tài liệu Báo cáo khoa học: Hypoxia reduces the expression of heme oxygenase-2 in various types of human cell lines A possible strategy for the maintenance of intracellular heme level pdf

Tài liệu Báo cáo khoa học: Hypoxia reduces the expression of heme oxygenase-2 in various types of human cell lines A possible strategy for the maintenance of intracellular heme level pdf
... Effects of hypoxia on HO-1 and HO-2 expression in human cell lines We initially analyzed the effects of hypoxia on the expression of HO-1 and HO-2 in human cell lines of Reduced expression of heme oxygenase-2 ... we have analyzed the effect of hypoxia on the expression levels of HO-1 and HO-2 in various types of human cell line, including erythroleukemia and hepatoma cells We have shown that hypoxia reduces ... R, Takahashi K, Takeda K, Furuyama K, Kaneko K, Takahashi S, Tamai M & Shibahara S (2004) Expression of heme oxygenase-1 is repressed by interferon-gamma and induced by hypoxia in human retinal...
  • 12
  • 235
  • 0

Tài liệu Báo cáo khoa học: Unique features of recombinant heme oxygenase of Drosophila melanogaster compared with those of other heme oxygenases studied docx

Tài liệu Báo cáo khoa học: Unique features of recombinant heme oxygenase of Drosophila melanogaster compared with those of other heme oxygenases studied docx
... a-mesocarbon of heme, leading to the exclusive a-meso-hydroxyheme formation The formation of three isomers of biliverdin by DmDHO implies that its heme pocket has a different structure from those of mammalian ... peroxide Properties of the heme DmDHO complex All HOs so far reported bind heme stoichiometrically to form stable complexes with absorption spectra resembling those of myoglobin Like other HOs, DmHO ... spectrum of the hemin–DmDHO complex exhibits a highly rhombic, highspin state of hemin, showing pronounced difference from that of the hemin complex of cyanobacterial heme oxygenase isoform-1,...
  • 12
  • 167
  • 0

Tài liệu Báo cáo khoa học: Oxygen tension regulates the expression of a group of procollagen hydroxylases docx

Tài liệu Báo cáo khoa học: Oxygen tension regulates the expression of a group of procollagen hydroxylases docx
... significant 5¢-CGGGATCCTAGACCGGCTAACAAGTA-3¢ 5¢-GGAATTCCAAGCAGTCCTCAGCTGT-3¢ 5¢-CGGGATCCTCGGACACCCTGTAAATG-3¢ 5¢-GGAATTCCAAGCAGTCCTCAGCTGT-3¢ 5¢-CGGGATCCTGCAGGCAGAATTCTTCA-3¢ 5¢-GGAATTCCCAGTCTGTGTTCAACCG-3¢ ... 5¢-AACTGGTGGCCGAGTGGG-3¢ 5¢-GCCCATTTCAAACTTGAG-3¢ 5¢-GCACATTGGGAAACGCTA-3¢ 5¢-AATTTTGCATTTGTGATC-3¢ 5¢-CCTGTTGTGCACATTGGG-3¢ 5¢-AATTTTGCATTTGTGATC-3¢ 5¢-ACCTCAAGATGTGCCACT-3¢ 5¢-TCCATCGGTCATGCTCTG-3¢ ... 5¢-GGAATTCCCAGTCTGTGTTCAACCG-3¢ 5¢-CGGGATCCTGCAGGCAGAATTCTTCA-3¢ 5¢-GGAATTCGCTGAACTGAGAGGTTAG-3¢ 5¢-CGGGATCCAGCAGTATGGTGTCCGTG-3¢ 5¢-GGAATTCACCGTCACTTCGCTTGAG-3¢ 5¢-AACTGGTGGCCGAGTGGG-3¢ 5¢-GCAGGGTGTCATAGGCCA-3¢...
  • 8
  • 143
  • 0

Xem thêm

Từ khóa: giai toan bang may tinh casioLuận văn về sự tập trung sản xuất và các tổ chức độc quyền.Bi kip giai he phuong trinh bang casio nguyen the lucSKKN: Một số phương pháp giải các bài toán quang hình học lớp 9tổng hợp các kỹ năng giải toán bằng máy tính casioleader market 2 inter downNâng cao chất lượng cho vay đối với các doanh nghiệp nhỏ và vừa tại chi nhánh ngân hàng thương mại cổ phần đầu tư và phát triển Bắc Ninh (LV thạc sĩ))Một số giải pháp phát triển thị trường tiêu thụ sản phẩm ô tô tại chi nhánh Toyota Thái Nguyên (LV thạc sĩ))LY THUYET VAT LY 12 TOAN TAP CO DAP ANTUYET CHIEU KINH NGHIEM NHAM NHANH TRONG GIAI BAI TAP VAT LIGIÁ TRỊ NỘI DUNG VÀ NGHỆ THUẬT TRONG TẬP TRUYỆN NGẮN “BÃI VÀNG, ĐÁ QUÝ, TRẦM HƯƠNG” CỦA NGUYỄN TRÍVỀ HỌC CHẾ TÍN CHỈ VÀ VIỆC ÁP DỤNG Ở VIỆT NAMMỘT SỐ BIỆN PHÁP PHÁT TRIỂN NGÔN NGỮ CHO TRẺ 18 – 24 THÁNG Ở TRƯỜNG MẦM NON NGA TRUNGMột số biện pháp chỉ đạo thực hiện giáo dục phát triển vận động cho trẻ mầm non tại trường mầm non Nga GiápMỘT SỐ KINH NGHIỆM NÂNG CAO CHẤT LƯỢNG THỰC HIỆN CHUYÊN ĐỀ GIÁO DỤC SỬ DỤNG NĂNG LƯỢNG TIẾT KIỆM, HIỆU QUẢ TRONG TRƯỜNG MẦM NON NGA LĨNHMột số biện pháp xây dựng chất lượng đội ngũ giáo viên ở trường Mầm non Nga Liên năm học 2015 – 2016MỘT SỐ BIỆN PHÁP XÂY DỰNG KẾ HOẠCH NĂM HỌC CỦA HIỆU TRƯỞNG TRƯỜNG MẦM NON NGA HƯNG, NGA SƠNHoạt động tạo hình là một hoạt động nghệ thuật chiếm một vị trí quan trọng. Hình thành nhân cách trẻ ngay từ những năm đầu của cuộc sống. Thông qua hoạt động tạo hình trẻ được khám phá ý thích vẻ đẹp kỳ diệu. Đây cũng là lứa tuổi ham hiểu biết có nhu cầuBỘ đề THI CHUẨN cấu TRÚC TOÁN 2017 CHÍ BẰNGEssentials of investments 9e by BODIE KANE and MARCUS