BAI TAP TIN SINH HOC 2012

SKKN: giải bài tập DT sinh học 12

SKKN: giải bài tập DT sinh học 12
... dạy học sinh học phát triển t sáng tạo khả phân tích học sinh, việc dạy tập có vai trò lớn trình hình thành cho học sinh phẩm chất Để giải tốt tập sinh học kiến thức quy luật di truyền đợc học ... Sinh học chuyển dần từ trình độ thực nghiệm sang trình độ lý thuyết Chính vậy, dạy học sinh học cần khuyến khích học sinh động sử dụng t Toán học việc giải vấn đề Sinh học, cụ thể việc giải tập ... bớc giải cho chuyên đề hẹp việc giải tập sinh học đặc biệt tập nâng cao Tuy nhiên, tài liệu tỏ có ích cho học sinh giúp em định hớng giải đắn tập sinh học Phần tập lai hai tính trạng, liên kết...
  • 14
  • 1,078
  • 6

MTCT tai lieu co cac bai tap hay Sinh hoc

MTCT tai lieu co cac bai tap hay Sinh hoc
... vi khuẩn E.Coli môi trường đáp ứng đầy đủ điều kiện để chúng phát triển, sau 10h người ta thu số lượng vi khuẩn E Coli 100.000 Biết khả phân chia E Coli Hãy tính số lần phân chia E Coli ban đầu ... bào tế bào ? Cách giải Kết Câu 6: Một số tế bào sinh dục đực sơ khai nguyên phân liên tiếp lần Trong số tế bào sinh có 87.5 % trở thành tế bào sinh tinh, trình thụ tinh sử dụng 6.25% số tinh ... lần phân chia E Coli ban đầu Cách giải Kết Câu 5: Xét tế bào sinh dưỡng I, II, III loài Các tế bào nguyên phân thời gian 3h Số tế bào sinh từ tế bào I số NST đơn NST lưỡng bội loài Các tế bào tế...
  • 3
  • 240
  • 3

Bài giảng TÀI LIỆU BIÊN SOẠN ĐỀ KIỂM TRA, XÂY DỰNG THƯ VIỆN CÂU HỎI VÀ BÀI TẬP MÔN SINH HỌC - CẤP THPT

Bài giảng TÀI LIỆU BIÊN SOẠN ĐỀ KIỂM TRA, XÂY DỰNG THƯ VIỆN CÂU HỎI VÀ BÀI TẬP   MÔN SINH HỌC - CẤP THPT
... GDĐT biên soạn đề kiểm tra theo ma trận đề Tổ chức xây dựng thư viện câu hỏi, tập để giáo viên học sinh sử dụng - Thư viện câu hỏi, tập - Ưu điểm thư viện câu hỏi, tập - Cách thức sử dụng thư viện ... Biên soạn đề kiểm tra Kĩ thuật biên soạn đề kiểm tra môn Sinh học THPT Ví dụ biên soạn đề kiểm tra môn Sinh học THPT Phần thứ ba 29 29 45 Thư viện câu hỏi tập 1.Về dạng câu hỏi 66 2.Về số lượng câu ... trung học tổ chức xây dựng thư viện câu hỏi, tập để giáo viên học sinh sử dụng biên soạn đề kiểm tra theo ma trận đề II Chuẩn bị: Tài liệu “Bồi dưỡng cán quản lí giáo viên biên soạn đề kiểm tra, xây...
  • 66
  • 568
  • 4

Bài giảng Tin sinh học: Chương 4 - ThS. Nguyễn Thành Luân

Bài giảng Tin sinh học: Chương 4 - ThS. Nguyễn Thành Luân
... nhóm chuyển tiếp từ purine (A G) hay pyrimidine (C T)  Transversion (Sự đảo đoạn)  Xảy nhóm chuyển từ purine sang pyrimidine ngược lại (A T, C G, A C, T G)  Tất đột biến đột biến ... dựng phát sinh loài dựa trình tự, suy có tỷ lệ đột biến chọn phát sinh loài thích hợp Bioinformatics 14 4/9/2013 Ví dụ •Xây dựng phát sinh loài dạng Parsimony cách vẽ trƣờng hợp có phát sinh loài ... 66 22 4/ 9/2013 Các kiến thức cần nhớ  Định nghĩa phát sinh loài  Ý nghĩa cấy phát sinh loài  Các dạng đột biến phát sinh  Các phương pháp xây dựng phát sinh loài  Các ứng dụng phát sinh loài...
  • 23
  • 257
  • 4

Bài giảng Tin sinh học: Chương 3 - ThS. Nguyễn Thành Luân

Bài giảng Tin sinh học: Chương 3 - ThS. Nguyễn Thành Luân
... mối quan hệ đồng đẳng gene hay sản phẩm-gen sở liệu thông tin mẫu có sẵn 3/ 26/20 13 So sánh trình tự theo cặp Khám phá thông tin về: -Chức -Cấu trúc chuỗi -Quan hệ tiến hóa Bắt cặp trình tự • Các ... Làm sáng tỏ lý giải sinh học protein: dựa vùng bảo toàn sinh học quan trọng (proteomics) • Xây dựng giả thiết cấu trúc 3- D protein • Xây dựng giả thiết chức protein 3/ 26/20 13 Phƣơng pháp nhận ... khác biệt phép so sánh 3/ 26/20 13 Tin sinh học trả lời mối quan hệ họ hàng BREAK - TIME Các phƣơng pháp so sánh trình tự thông dụng • Phương pháp so sánh ma trận điểm (Dot-matrix) • Phương pháp...
  • 21
  • 212
  • 3

Bài giảng Tin sinh học: Chương 2 - Thạc sĩ. Nguyễn Thành Luân

Bài giảng Tin sinh học: Chương 2 - Thạc sĩ. Nguyễn Thành Luân
... (GUMC) CSDL Protein  SWISS-PROT-1 nguồn CSDL trình tự protein trì hợp tác Viện Tin sinh học Thụy Sĩ (the Swiss Institute for Bioinformatics-SIB) Viện Tin Sinh học Châu Âu (EBI-European Bioinformatics ... khuẩn) • UNA-Unannotated (Chưa xác định) 13/03 /20 13 Hệ thống phân loại chức GenBank • PAT –Patent • EST -Expressed sequence tag • STS -Sequence tagged site • GSS -Genome survey sequence • HTG-High ... 13 13/03 /20 13 ORF VIEW DESCRIPTION VIEW 14 13/03 /20 13 Các dạng BLAST  Nucleotide-nucleotide BLAST (blastn)  Protein-protein BLAST (blastp)  Position-Specific Iterative BLAST (PSI-BLAST) (blastpgp)...
  • 30
  • 441
  • 8

Bài giảng Tin sinh học: Chương 1 - ThS. Nguyễn Thành Luân

Bài giảng Tin sinh học: Chương 1 - ThS. Nguyễn Thành Luân
... PCR •200 0-2 008: gia tăng việc khởi đầu dự án giải mã toàn bộ bộ gen loài ngƣời 3/8/2 013 Lịch sử phát triển của Tin sinh học 3/8/2 013 TIN SINH HỌC LÀ GÌ?? TIN SINH HỌC LÀ GÌ?? 10 3/8/2 013 Khái ... Ứng dụng chương trình so sánh trình tự xác định trình tự gốc virus cảm cúm Thuật ngữ Tin sinh học lần công nhận toàn giới vào năm 19 91 3/8/2 013 Lịch sử phát triển Tin sinh học 19 9 4-2 004: Số ... trình tự protein thành đồ cấu trúc trình tự protein Margaret Dayhoff (19 25 -1 9 83) Lịch sử Tin sinh học Tin sinh học giống ngành học biết đến từ thập niên 19 60 trước công bố tên gọi Năm 19 65, gọi tên...
  • 33
  • 321
  • 2

Bai giang tin sinh hoc 2

Bai giang tin sinh hoc 2
... trình tự sinh học 15 Một số mã số truy cập RefSeq database mRNAs and Proteins  NM_ 123 456  NP_ 123 456  NR_ 123 456  XM_ 123 456  XP_ 123 456  XR_ 123 456 Chromosome NC_ 123 455 Assemblies NT_ 123 456 Curated ... genomes, human chromosomes Contig Tìm kiếm trình tự sinh học 16 Ví dụ 1: NM_ 123 456Curated mRNA NM_ 123 456 Tìm kiếm trình s sinh học 17 V í dụ 2: NC_ 123 45 Giới thiệu môn học 18 Kết tìm kiếm gene Giới ... Câu hỏi 2: Trình tự DNA dài ? Nó mã hoá cho gen gì? Công trình đăng tải tạp chí nào? Tác giả ai? Trả lời 2: Giới thiệu môn học 21 Tìm kiếm trình tự protein Tìm kiếm trình tự sinh học 22 Tìm kiếm...
  • 46
  • 146
  • 0

Bai giang tin sinh hoc 3

Bai giang tin sinh hoc 3
... môn học 30 Chức đánh giá Giới thiệu môn học 31 Sử dụng PDA (primer Design Assistnat) http://dbb.nhri.org.tw/primer/ Giới thiệu môn học 32 Sử dụng phần mềm FastPCR Giới thiệu môn học 33 Kết phản ... 10R1_ 137 85- 138 06 Giới thiệu môn học 43 Bài tập Hãy thiết kế đoạn mồi dùng cho phản ứng PCR nhằm khuếch đại đoạn gen từ vị trí 156 đến 620 trình tự gen myoglobin người, có mã số truy cập NM_2 033 78 ... mồi xuôi Giới thiệu môn học 34 Kết phân tích mồi ngược Giới thiệu môn học 35 Chức đánh giá độ đặc hiệu mồi Giới thiệu môn học 36 Kết độ đặc hiệu mồi Giới thiệu môn học 37 Kiểm tra độ đặc hiệu mồi...
  • 44
  • 192
  • 0

Bai giang tin sinh hoc 4

Bai giang tin sinh hoc 4
... đích tìm (mối quan hệ) đồng đẳng gene hay sản phẩm-gen sở liệu thông tin mẫu có sẵn Thông tin hữu ích để trả lời loạt câu hỏi sinh học khác Giới thiệu môn học Ứng vài ví dụ câu hỏi mà nhà nghiên ... Giới thiệu môn học 31 Giới thiệu môn học 32 Giới thiệu môn học 33 Tin sinh học trả lời mối quan hệ họ hàng Giới thiệu môn học 34 ... trình mở rộng kết thúc điểm cặp Hits mở rộng thêm KENFDKARFSGTWYAMAKKDPEG 50 MKGLDIQKVAGTWYSLAMAASD 44 Mở rộng Hit! RBP (query) lactoglobulin (hit) Mở rộng Giới thiệu môn học 12 Những chuỗi nucleotide...
  • 34
  • 175
  • 2

Bai 5 tin sinh hoc

Bai 5 tin sinh hoc
... - 35 site (TTGACA) UAA,UAG UGA Terminator (TAA, TAG, TGA) 3’ ORF Initiation codon Stop codon 5 Mở đầu: AUG (ATG, GTG, CTG, TTG) ORF - Khung đọc mở  Trong Di truyền phân tử, ORF phận gene sinh ... chép sinh vật prokaryotic eukaryotic Quá trình phiên mã RNA từ DNA Dịch mã theo quy tắc gene protein Dịch mã Prokaryotes Promoter Gene1 Gene2 Transcription Gene N Terminator RNA Polymerase mRNA 5 ... DNA đọc khung đọc sinh vật có DNA mạch đôi; khung đọc mạch    * * *  * * * Forward DNA strand Reverse DNA strand * *  Start signal * Stop signal   * *   * *   F4 F5 F6 Total ORFs in...
  • 50
  • 348
  • 1

Bai giang tin sinh hoc 6

Bai giang tin sinh hoc 6
... Thêm cặp nuclêôtít Thay cặp nuclêôtít Đảo vị trí cặp nuclêôtít Giới thiệu môn học Nguyên nhân phát sinh đột biến gen  Vai trò đột biến gen: Sự biến đổi cấu trúc phân tử gen dẫn đến biến đổi cấu ... đại diện, ví dụ ATC-G C Bất chuỗi kí tự nucleotide mà dài gọi trình tự ADN Mặt khác, tùy vào chức sinh học, ngữ cảnh, mà trình tự mang mang mã không mang mã (noncoding DNA) Các trình tự DNA "ADN ... trình tự DNA Xóa nucleotide S1: ATTCCGGTACGT TGCCCC S2: ATTCAAAGGTACGTTGCCCC Giới thiệu môn học 16 Xóa đoạn nucleotide Giới thiệu môn học 17 Kết phân tích dotplot blast Giới thiệu môn học 18 Phân...
  • 43
  • 128
  • 0

On tap tin sinh hoc

On tap tin sinh hoc
... BÀI 1: TÌM KIẾM TRÌNH TỰ SINH HỌC Trình tự sinh học: DNA, RNA, protein Tìm kiếm trình tự sinh học Nguyên tắc tìm kiếm trình tự sau giải trình tự 1.Tìm từ ... tìm kiếm Kết cần tìm Lọc trình tự Tìm kiếm trình tự sinh học Tìm kiếm trình tự sinh học qua NCBI -Gene -Nucleotide - Protein Tìm kiếm trình tự sinh học Tìm kiếm trình tự qua mã số truy cập Tìm ... số GI Tìm kiếm trình tự sinh học Kết tìm trình tự DNA qua mã số truy cập Giới thiệu môn học Tìm kiếm trình tự qua tên gene Tìm kiếm trình tự sinh học Tìm kiếm trình tự sinh học Cách lấy trình...
  • 26
  • 199
  • 0

Xem thêm

Từ khóa: Đánh giá rủi ro trong thẩm định dự án vay vốn tại Ngân hàng thương mại cổ phần quốc tế Việt NamĐào tạo nghề cho lao động nông thôn vùng đồng bằng Sông Hồng trong thời kỳ công nghiệp hóa, hiện đại hóa.PDFĐầu tư nâng cao năng lực cạnh tranh của ngân hàng thương mại cổ phần công thương Việt Nam - Chi nhánh Nam Thăng LongĐầu tư nâng cao năng lực cạnh tranh của Ngân Hàng Thương mại cổ phần Ngoại Thương Việt Nam.PDFĐầu tư nâng cao năng lực cạnh tranh tại Công ty TNHH thương mại và sản xuất Lợi Đônggiáo trình tin học đại cương tập 3kiến trúc mạng ponBachelor of AccountingNghiên cứu biến tính than hoạt tính bằng MnO2 và TiO2 làm vật liệu xử lý asen và amoni trong nướcGood Governance in the Public Sector— Consultation Draft for an International FrameworkReducing Employee Turnover in the Big Four Public Accounting FirmValue Investing: The Use of Historical Financial Statement Information to Separate Winners from LosersComparative Analysis Of Accounting Information Systems Of The Netherlandsand Gungary In Order To Reveal The Possibilities Of Improvingthe Gungarian SystemXây dựng nền dân chủ XHCN và Nhà nước XHCNđề cương chi tiết quản trị kinh doanhAccounting For Stream Bank Storage For A Seasonal Groundwater ModelThesis Optima FundA Return on Investment Model for Software Configuration ManagementBSc (Hons) in Applied Accounting and Research and Analysis Projectchủ nghĩa duy tâm _ ĐHAG
Nạp tiền Tải lên
Đăng ký
Đăng nhập