Luận văn định danh nấm phytophthora spp bằng các kỹ thuật sinh học phân tử

Luận văn : ĐỊNH DANH NẤM Phytophthora spp. BẰNG CÁC KỸ THUẬT SINH HỌC PHÂN TỬ part 3 pps

Luận văn : ĐỊNH DANH NẤM Phytophthora spp. BẰNG CÁC KỸ THUẬT SINH HỌC PHÂN TỬ part 3 pps
... 33 Như vậy, kết chạy PCR định danh hai mẫu Phytophthora Để định danh hai mẫu nấm trên, tiến hành tinh sản phẩm PCR nhằm mục đích giải trình tự chúng cách xác 4.4 Kết tinh ... Phần KẾT LUẬN VÀ ĐỀ NGHỊ 5.1 Kết luận Kết giải trình tự cho ta số kết luận nh : - Ứng dụng kỹ thuật PCR phát hai mẫu nấm tiêu Bà Rịa sầu riêng Đồng Nai thuộc giống Phytophthora chưa xác định rõ ... loài nấm đối tượng - Áp dụng qui trình định danh cho nghiên cứu loài nấm loại lan Lâm Đồng 41 Phần TÀI LIỆU THAM KHẢO Tiếng Việt Trịnh Thị Phương Vy, 2005 Định danh nấm Phytopthora spp kỹ thuật...
  • 21
  • 174
  • 0

Luận văn : ĐỊNH DANH NẤM Phytophthora spp. BẰNG CÁC KỸ THUẬT SINH HỌC PHÂN TỬ part 2 ppt

Luận văn : ĐỊNH DANH NẤM Phytophthora spp. BẰNG CÁC KỸ THUẬT SINH HỌC PHÂN TỬ part 2 ppt
... hình thái sinh học phân tử Phương pháp sinh học phân tử dùng cho nghiên cứu chi tiết, sử dụng PCRRFLP phân tích đoạn gen ITS1-5,8S-ITS2 vùng ITS thuộc DNA ribosome 180 dòng phân lập Phân tích ... Nghệ Sinh Học Thực Vật – Trung Tâm Phân Tích Thí Nghiệm Hóa Sinh – Trường Đại Học Nông Lâm TP Hồ Chí Minh 3 .2 Vật liệu hóa chất: Chúng tiến hành tăng sinh nhân sinh khối mẫu nấm Phytophthora phân ... trình tăng sinh, nhân sinh khối Chúng áp dụng qui trình tăng sinh nhân sinh khối nấm Phytophthora kỹ sư Trịnh Thị Phương Vy (20 05) để nhân sinh khối mẫu nấm rút số nhận xét: - Tất mẫu nấm phát...
  • 21
  • 120
  • 0

Luận văn : ĐỊNH DANH NẤM Phytophthora spp. BẰNG CÁC KỸ THUẬT SINH HỌC PHÂN TỬ part 1 docx

Luận văn : ĐỊNH DANH NẤM Phytophthora spp. BẰNG CÁC KỸ THUẬT SINH HỌC PHÂN TỬ part 1 docx
... ĐỊNH DANH NẤM Phytophthora spp BẰNG CÁC KỸ THUẬT SINH HỌC PHÂN TỬ ” nhằm hoàn thiện qui trình định danh nấm Phytophthora kỹ thuật sinh học phân tử 2 1. 2 Mục đích – yêu cầu đề tài 1. 2 .1 Mục đích ... ĐÀO TẠO ĐẠI HỌC NÔNG LÂM TP HỒ CHÍ MINH BỘ MÔN CÔNG NGHỆ SINH HỌC ***** ĐỊNH DANH NẤM Phytophthora spp BẰNG CÁC KỸ THUẬT SINH HỌC PHÂN TỬ LUẬN VĂN KỸ SƢ CHUYÊN NGÀNH:CÔNG NGHỆ SINH HỌC Giáo viên ... học phân tử ta giải khó khăn Các kỹ thuật sinh học phân tử đại với kỹ thuật nh : kỹ thuật PCR, kỹ thuật sử dụng enzyme cắt, kỹ thuật đọc trình tự,… tác động lên cấu trúc phân tử DNA loài nấm từ...
  • 21
  • 212
  • 0

Định danh nấm Phytophthora spp. bằng các kỹ thuật sinh học phân tử

Định danh nấm Phytophthora spp. bằng các kỹ thuật sinh học phân tử
... Chúng thực đề tài ” ĐỊNH DANH NẤM Phytophthora spp BẰNG CÁC KỸ THUẬT SINH HỌC PHÂN TỬ ” nhằm hoàn thiện qui trình định danh nấm Phytophthora kỹ thuật sinh học phân tử 2 1.2 Mục đích – yêu cầu ... học phân tử ta giải khó khăn Các kỹ thuật sinh học phân tử đại với kỹ thuật như: kỹ thuật PCR, kỹ thuật sử dụng enzyme cắt, kỹ thuật đọc trình tự,… tác động lên cấu trúc phân tử DNA loài nấm từ ... ĐÀO TẠO ĐẠI HỌC NÔNG LÂM TP HỒ CHÍ MINH BỘ MÔN CÔNG NGHỆ SINH HỌC ***** ĐỊNH DANH NẤM Phytophthora spp BẰNG CÁC KỸ THUẬT SINH HỌC PHÂN TỬ LUẬN VĂN KỸ SƢ CHUYÊN NGÀNH:CÔNG NGHỆ SINH HỌC Giáo viên...
  • 63
  • 511
  • 5

Sử dụng các kỹ thuật sinh học phân tử trong phân tích đa dạng và định danh loài ở tập đoàn cây dó bầu (aquilaria sp ) tại hà tĩnh

Sử dụng các kỹ thuật sinh học phân tử trong phân tích đa dạng và định danh loài ở tập đoàn cây dó bầu (aquilaria sp ) tại hà tĩnh
... sinh trưởng phát triển chưa đủ sở để định danh phân biệt loài Xuất phát từ yêu cầu đặt định thực đề tài Sử dụng kỹ thuật sinh học phân tử phân tích đa dạng định danh loài tập đoàn bầu (Aquilaria ... sp Tĩnh 10 T7 Aquiaria sp Tĩnh 11 T8 Aquiaria sp Tình 12 T9 Aquiaria sp Tĩnh 13 T 10 Aquiaria sp Tĩnh 14 T 11 Aquiaria sp Tĩnh 15 T 14 Aquiaria sp Tĩnh 16 PQ64 Aquiaria sp ... (Aquilaria sp. ) Tĩnh. ” Luận văn thạc sĩ Sinh học Hoàng Đăng Hiếu Chương TỔNG QUAN TÀI LIỆU 1.1 Tổng quan bầu 1.1.1 Đặc điểm phân loại vị trí phân bố bầu Cây bầu (Aquilaria sp. ) loài thực...
  • 72
  • 23
  • 0

Sử dụng các kỹ thuật sinh học phân tử trong phân tích đa dạng và định danh loài ở tập đoàn cây dó bầu (aquilaria sp ) tại hà tĩnh

Sử dụng các kỹ thuật sinh học phân tử trong phân tích đa dạng và định danh loài ở tập đoàn cây dó bầu (aquilaria sp ) tại hà tĩnh
... sinh trưởng phát triển chưa đủ sở để định danh phân biệt loài Xuất phát từ yêu cầu đặt định thực đề tài Sử dụng kỹ thuật sinh học phân tử phân tích đa dạng định danh loài tập đoàn bầu (Aquilaria ... sp Tĩnh 10 T7 Aquiaria sp Tĩnh 11 T8 Aquiaria sp Tình 12 T9 Aquiaria sp Tĩnh 13 T 10 Aquiaria sp Tĩnh 14 T 11 Aquiaria sp Tĩnh 15 T 14 Aquiaria sp Tĩnh 16 PQ64 Aquiaria sp ... (Aquilaria sp. ) Tĩnh. ” Hoàng Đăng Hiếu Luận văn thạc sĩ Sinh học Chương TỔNG QUAN TÀI LIỆU 1.1 Tổng quan bầu 1.1.1 Đặc điểm phân loại vị trí phân bố bầu Cây bầu (Aquilaria sp. ) loài thực...
  • 69
  • 83
  • 0

Sử dụng các kỹ thuật sinh học phân tử trong phân tích đa dạng cà định dạng của tập đoàn cây dó bầu ( aquilaria SP ) tại hà tĩnh

Sử dụng các kỹ thuật sinh học phân tử trong phân tích đa dạng cà định dạng của tập đoàn cây dó bầu ( aquilaria SP ) tại hà tĩnh
... giấy bầu , Trung tâm nghiên cứu Lâm đặc sản, Viện Khoa học Lâm nghiệp Việt Nam, Viện Công nghiệp giấy Cenlulose Phạm Hồng Sơn (2 00 6), Giáo trình kỹ thuật sinh học phân tử , Nhà xuất Đại học ... xứ từ Tĩnh Đây coi dấu hiệu để bước đầu phân biệt 18 cá thể bầu mà nghiên cứu dù hệ số tương đồng 18 mẫu cao ( 99,0 - 100% ) 3.5.4 Kết xác định phân tích trình tự gen ITS Kết phân tích trình ... Euphytica, (8 9), pp 257-265 18 Kiet L., Kessler PJA and Eurlings M (2 00 5), “A new species of Aquilaria (Thymelaceaceae) from Vietnam”, Blumea, (5 0), pp 135-141 19 Kress W J., Erickson D L (2 00 8), “DNA...
  • 13
  • 294
  • 0

sử dụng các kỹ thuật sinh học phân tử trong phân tích đa dạng cà định dạng của tập đoàn cây dó bầu ( aquilaria sp.) tại hà tĩnh

sử dụng các kỹ thuật sinh học phân tử trong phân tích đa dạng cà định dạng của tập đoàn cây dó bầu ( aquilaria sp.) tại hà tĩnh
... ĐẠI HỌC QUỐC GIA HÀ NỘI TRƯỜNG ĐẠI HỌC KHOA HỌC TỰ NHIÊN - HOÀNG ĐĂNG HIẾU SỬ DỤNG CÁC KỸ THUẬT SINH HỌC PHÂN TỬ TRONG PHÂN TÍCH ĐA DẠNG VÀ ĐỊNH DANH LOÀI CỦA TẬP ĐOÀN CÂY DÓ BẦU (AQUILARIA ... tích đa dạng định danh loài tập đoàn bầu (Aquilaria sp.) Tĩnh. ” Luận văn thạc sĩ Sinh học Hoàng Đăng Hiếu Chƣơng TỔNG QUAN TÀI LIỆU 1.1 Tổng quan bầu 1.1.1 Đặc điểm phân loại vị trí phân ... xanh, ẩm nguyên sinh: A crassna (Dó bầu, tía, trắng), A baillonii (Dó Gạch), A rugosa (Dó Quả Nhăn), A malaccensis (Dó Mã Lai), A sinensis (Dó Trung Quốc), A banaensis (Dó Bà Nà) Trong A crassna...
  • 70
  • 260
  • 1

Xác định vi khuẩn lậu và phát hiện đột biến gen kháng ciprofloxacin bằng kỹ thuật sinh học phân tử tại viện Da liễu Quốc gia từ năm 2005 - 2007

Xác định vi khuẩn lậu và phát hiện đột biến gen kháng ciprofloxacin bằng kỹ thuật sinh học phân tử tại viện Da liễu Quốc gia từ năm 2005 - 2007
... nhuộm soi nuôi cấy - Tìm hiểu kháng kháng sinh chủng vi khuẩn lậu phân lập đợc Vi n Da liễu Quốc Gia từ năm 200 5- 2007 - Phát đột biến gen liên quan đến kháng ciprofloxacin vi khuẩn lậu ý nghĩa thực ... đợc Vi n Da liễu Quốc Gia từ năm 200 5- 2007 (n=503) + Tỷ lệ kháng kháng sinh nhóm năm 200 5- 200 6-2 007: Ciprofloxacin 80,9% - 82,1% - 89,2% Penicillin 35,2% - 31,1% - 37,2% Tetracyclin 9,9% - 16,5% ... lợng đột biến gyrA 2 2 2 2 18 Số lợng đột Tổng số đột biến biến parC gen 0-1 2-3 0-1 2-3 0-1 2-3 3 3 3 6-9 2 4-2 7 3.4.7 Phân tích đột biến gen gyrA Bảng 3.24 Phân tích đột biến gen gyrA 69 chủng vi...
  • 27
  • 438
  • 0

LUẬN VĂN CÔNG NGHỆ SINH HỌC TÌM HIỂU QUY TRÌNH PHÁT HIỆN VI KHUẨN LAO KHÁNG THUỐC BẰNG KỸ THUẬT SINH HỌC PHÂN TỬ

LUẬN VĂN CÔNG NGHỆ SINH HỌC TÌM HIỂU QUY TRÌNH PHÁT HIỆN VI KHUẨN LAO KHÁNG THUỐC BẰNG KỸ THUẬT SINH HỌC PHÂN TỬ
... ch m tr phát hi n u tr b nh lao Chính v y m t phương pháp phát hi n vi khu n lao kháng thu c nhanh chóng xác u c n thi t nh t ð tài th c hi n nh m tìm hi u v quy trình phát hi n vi khu n lao Mycobacterium ... hình nghiên c u b nh lao kháng thu c 19 2.4 Vi khu n lao kháng thu c 20 2.4.1 ð c m giúp vi khu n lao có kh kháng thu c 20 2.4.1 Vi khu n lao đ t bi n gen kháng thu c 21 Chương ... , giúp phát hi n b nh nhanh chóng xác đ u tr k p th i Nhi m v nghiên c u Tìm hi u v quy trình phát hi n lao kháng thu c b ng k thu t sinh h c phân t ðánh giá đư c đ nh y xác c a quy trình Phương...
  • 57
  • 255
  • 1

LUẬN VĂN CÔNG NGHỆ SINH HỌC TÌM HIỂU QUY TRÌNH PHÁT HIỆN VI KHUẨN LAO KHÁNG THUỐC BẰNG KỸ THUẬT SINH HỌC PHÂN TỬ

LUẬN VĂN CÔNG NGHỆ SINH HỌC TÌM HIỂU QUY TRÌNH PHÁT HIỆN VI KHUẨN LAO KHÁNG THUỐC BẰNG KỸ THUẬT SINH HỌC  PHÂN TỬ
... ch m tr phát hi n u tr b nh lao Chính v y m t phương pháp phát hi n vi khu n lao kháng thu c nhanh chóng xác u c n thi t nh t ð tài th c hi n nh m tìm hi u v quy trình phát hi n vi khu n lao Mycobacterium ... hình nghiên c u b nh lao kháng thu c 19 2.4 Vi khu n lao kháng thu c 20 2.4.1 ð c m giúp vi khu n lao có kh kháng thu c 20 2.4.1 Vi khu n lao đ t bi n gen kháng thu c 21 Chương ... , giúp phát hi n b nh nhanh chóng xác đ u tr k p th i Nhi m v nghiên c u Tìm hi u v quy trình phát hi n lao kháng thu c b ng k thu t sinh h c phân t ðánh giá đư c đ nh y xác c a quy trình Phương...
  • 57
  • 181
  • 2

ĐỊNH DANH các VI KHUẨN CHUYỂN hóa đạm BẰNG PHÉP THỬ SINH hóa và kỹ THUẬT SINH học PHÂN tử

ĐỊNH DANH các VI KHUẨN CHUYỂN hóa đạm BẰNG PHÉP THỬ SINH hóa và kỹ THUẬT SINH học PHÂN tử
... nghiên cứu vi c xác định vị trí phân loại nhóm vi khuẩn chuyển hóa đạm kỹ 43 Kỷ yếu Hội nghị khoa học thủy sản lần 4: 42-54 Trường Đại học Cần Thơ thuật sinh học phân tử phép thử sinh hóa thực ... (2000) phân lập Nitrobacter từ đất 49 Kỷ yếu Hội nghị khoa học thủy sản lần 4: 42-54 Trường Đại học Cần Thơ 3.2 Định danh kỹ thuật sinh học phân tử 3.2.1 Kết định danh vi khuẩn Bacillus kỹ thuật ... QUẢ VÀ THẢO LUẬN 3.1 Phép thử sinh hóa 3.1.1 Các đặc tính sinh hóa Bacillus 47 Kỷ yếu Hội nghị khoa học thủy sản lần 4: 42-54 Trường Đại học Cần Thơ Kết xác định đặc tính sinh hóa 05 chủng vi khuẩn...
  • 13
  • 277
  • 2

Xác định kiểu gen virut viêm gan c trong huyết thanh bệnh nhân viêm gan c bằng kỹ thuật sinh học phân tử real time – PCR

Xác định kiểu gen virut viêm gan c trong huyết thanh bệnh nhân viêm gan c bằng kỹ thuật sinh học phân tử real time – PCR
... trình tự gen type 6h (Hình 3.8) 78 HCV GAGGTACTTGCCACATATTGCGGCTTTCCCTCCTTGGGCGATAAGTTTGGCCC TGACCGCTCGGGCTCGGTGTCTCCAAGCTCTCAAGGGAGGAGCCCCAAGTTTTCT GAGGCATGATGCCACCCGATTGAGTTCGCCGGGAGAGTACCCATGGAGTGAGAA ... TGCGGCCATGCCGTGGAGTCTTTGAATGATCACTGGGAGATCAAGCGGAGTGATT GAATATGTGACTCCGTAGATATCGAAGTCAAGTGCCCTGTCCAAAGTCTCCTGTG CCTGGAGTATTTGAAAGAAATGGGTCATGAGTACCATACGCACCCAAATGGTGG GGGCATACATAATGATGTTCCCTAACCATGAATTCACAGGAGTGTGGCGAGCGGT ... Với m c đích khuyến c o bệnh nhân lựa chọn phương pháp x c định genotype, chọn đề tài: X c định kiểu gen virus viêm gan C huyết bệnh nhân viêm gan C kỹ thuật sinh h c phân tử RT -PCR , với m c tiêu...
  • 19
  • 401
  • 1

TIỂU LUẬN:CHẨN ĐOÁN BỆNH GIA SÚC, GIA CẦM BẰNG KỸ THUẬT SINH HỌC PHÂN TỬ ppt

TIỂU LUẬN:CHẨN ĐOÁN BỆNH GIA SÚC, GIA CẦM BẰNG KỸ THUẬT SINH HỌC PHÂN TỬ ppt
... , nested PCR , cắt phân đoạn đa hình (RFLP), ELISA Với kỹ thuật trên, kỹ thuật RT-PCR định lượng với thuốc nhuộm TaqMan xem thành công cho việc nghiên cứu chuẩn đoán bệnh Kỹ thuật phát cho thấy ... dụng để chuẩn đoán PRRS Tùy thuộc vào thời gian nhiễm bệnh mẫu thí nghiệm có sẵn mà lựa chọn phương pháp chuẩn đoán thích hợp Để chẩn đoán phân biệt type virus PRRS ta dùng kỹ thuật RTPCR , nested ... độ gây bệnh nguy hiểm Vì viêc chuẩn đoán phân biệt type điều cần thiết ta áp dụng việc sử dụng nguồn vaccine có hiệu quả, sử dụng phương pháp phòng chống bệnh thích hợp Phát kháng thể, phân lập...
  • 17
  • 321
  • 0

Nghiên cứu giải mã một phần hệ gen ty thể của loài sán lá gan nhỏ Opisthorchis viverrini (mẫu Việt Nam) và so sánh với các chủng của thế giới bằng các phương pháp sinh học phân tử

Nghiên cứu giải mã một phần hệ gen ty thể của loài sán lá gan nhỏ Opisthorchis viverrini (mẫu Việt Nam) và so sánh với các chủng của thế giới bằng các phương pháp sinh học phân tử
... thit thc v nghiờn cu gen hc h gen ty th ó nờu trờn, chỳng tụi tin hnh ti: Nghiờn cu gii mó mt phn h gen ty th ca loi sỏn lỏ gan nh Opisthorchis viverrini (mu Vit Nam) v so sỏnh vi cỏc chng ca ... Cha cú ton b h gen ty th gii trỡnh mt cỏch hon chnh no ca O viverrini c ng ký vo Ngõn hng gen Nh vy, t l cn cú d liu sinh hc phõn t h gen ty th cng nh ca h gen nhõn ca sỏn lỏ gan nh ca Vit Nam ... truyn h gen ty th 1.2 H GEN TY TH V NG DNG TRONG NGHIấN CU Kí SINH TRNG Hin ó cú rt nhiu loi ó cú h gen ty th c gii mó ton b hoc mt phn, cung cp nguyờn liu chui nucleotide v amino acid cho so sỏnh...
  • 27
  • 293
  • 0

Xem thêm

Từ khóa: xác định nhanh vi khuẩn lao và lao kháng thuốc bằng kỹ thuật sinh học phân tửphát hiện dna phôi thai trong máu mẹ bằng kỹ thuật sinh học phân tửphát hiện dna phôi thai trong máu mẹ bằng kỹ thuật sinh học phân tử nhằm hướng tới chẩn đoánbằng chứng tiến hóa sinh học phân tửnguyễn cao luận hồ châu lâm nguyễn nguyên khôi nguyễn nguyên trường nguyễn hữu dũng 2007 quot các kỹ thuật lọc máu liên tục thay thế thận quot tạp chí y học việt nam 2 tr 38 45phương pháp định danh sinh học phân tửđịnh danh sinh học phân tử chủng lb7tiểu luận sinh học phân tửbằng chứng sinh học phân tửphân loại bằng sinh học phân tửtiểu luận về sinh học phân tửtiểu luận môn sinh học phân tửbài tiểu luận sinh học phân tửsinh học phân tử nguyễn văn thanhphân loại vi sinh vật bằng sinh học phân tửRecords and Information Management February 2013Thiết Lập Hệ Thống Kiểm Soát Nội Bộ Doanh NghiệpResumes for High School StudentsWORKSHOP PRESENTATIONNDiversity in the Workplace & Environmental ProtectionHi Techwealthpresentation WpMột Số Vấn Đề Chung Về Mô Hình Trường Học Mới Việt NamDr. Peter Gumpel Mein Capital AdvisorsSlides Planning and structuring your reportSpring 2011 Final Project PresentationHow To Improve Billing And CollectionsStock Holding Corporation of India [e-Registration - managing stamp-paper-less system]How To Pass Actuarial ExamsExpatriate Risk Management Kidnapping and Ransom CMMEHypercommercialism, The Media and Oligopolistic MarketsFDIC presentation on Asset Liability Management Process 4-11Khái Quát Văn Học Hiện Đại Nhật BảnCommunicating The FactsGavrilova DemographicsGDNAGML September FinalFinal
Đăng ký
Đăng nhập