Nghiên cứu tạo que thử để phát hiện nhanh một số độc tố ruột của tụ cầu khuẩn trong thực phẩm

Nghiên cứu tạo que thử để phát hiện nhanh một số độc tố ruột của tụ cầu khuẩn trong thực phẩm

Nghiên cứu tạo que thử để phát hiện nhanh một số độc tố ruột của tụ cầu khuẩn trong thực phẩm
... sinh an toàn thực phẩm cho sản phẩm lƣu hành nƣớc sản phẩm thực phẩm xuất Từ thực tế trên, thực đề tài luận án: Nghiên cứu tạo que thử để phát nhanh số độc tố ruột tụ cầu khuẩn thực phẩm Mục tiêu ... kháng nguyên 1.4.2 Một số nghiên cứu tạo que thử phát độc tố ruột tụ cầu thực phẩm Gần đây, số nghiên cứu phát triển que thử ứng dụng kỹ thuật sắc ký miễn dịch để phát SE thực phẩm đƣợc công bố ... hiệu với loại độc tố tụ cầu phát triển đƣợc que thử sắc ký miễn dịch phát loại độc tố ruột tụ cầu phổ biến Trong luận án này, sử dụng ƣu điểm để tạo que thử phát loại độc tố ruột tụ cầu dựa kháng...
  • 131
  • 80
  • 1

tóm tắt luận án tiến sĩ Nghiên cứu tạo que thử để phát hiện nhanh các độc tố ruột của tụ cầu khuẩn trong thực phẩm

tóm tắt luận án tiến sĩ Nghiên cứu tạo que thử để phát hiện nhanh các độc tố ruột của tụ cầu khuẩn trong thực phẩm
... toàn thực phẩm phần lớn dừng lại việc phát vi khuẩn tụ cầu mà chƣa phân tích tới SE, nguyên nhân gây NĐTP tụ cầu Từ thực tế trên, thực đề tài luận án: Nghiên cứu tạo que thử để phát nhanh độc tố ... que thử cần sử dụng kháng thể 1.4.2 Một số nghiên cứu chế tạo que thử để phát độc tố ruột tụ cầu thực phẩm Năm 2009, nghiên cứu Boyle cộng tạo que thử phát SEB sữa với ngƣỡng phát nằm khoảng từ ... Tiếp tục nghiên cứu nhằm tối ƣu hóa que thử để tăng độ nhạy phát với loại độc tố ruột tụ cầu (SEA-SEE), đơn giản hóa quy trình phân tích để vào sản xuất, ứng dụng để phát loại độc tố nhiều loại thực...
  • 27
  • 109
  • 0

Tóm tắt dự thảo luận án tiến sĩ sinh học nghiên cứu tạo que thử để phát hiện nhanh các độc tố ruột của tụ cầu khuẩn trong thực phẩm

Tóm tắt dự thảo luận án tiến sĩ sinh học nghiên cứu tạo que thử để phát hiện nhanh các độc tố ruột của tụ cầu khuẩn trong thực phẩm
... toàn thực phẩm phần lớn dừng lại việc phát vi khuẩn tụ cầu mà chƣa phân tích tới SE, nguyên nhân gây NĐTP tụ cầu Từ thực tế trên, thực đề tài luận án: Nghiên cứu tạo que thử để phát nhanh độc tố ... que thử cần sử dụng kháng thể 1.4.2 Một số nghiên cứu chế tạo que thử để phát độc tố ruột tụ cầu thực phẩm Năm 2009, nghiên cứu Boyle cộng tạo que thử phát SEB sữa với ngƣỡng phát nằm khoảng từ ... độc tố ruột tụ cầu khuẩn thực phẩm Mục tiêu đề tài Mục tiêu đề tài luận án phát triển sinh phẩm dựa kỹ thuật sắc ký miễn dịch để phát nhanh SE từ SEA đến SEE thực phẩm Nội dung nghiên cứu đề...
  • 28
  • 81
  • 0

Nghiên cứu tạo đột biến khử độc và biểu hiện gen mã hóa kháng nguyên tái tổ hợp staphylococcal enterotoxin b (seb) phục vụ cho việc chế tạo kít phát hiện tụ cầu vàng trong thực phẩm

Nghiên cứu tạo đột biến khử độc và biểu hiện gen mã hóa kháng nguyên tái tổ hợp staphylococcal enterotoxin b (seb) phục vụ cho việc chế tạo kít phát hiện tụ cầu vàng trong thực phẩm
... tham gia thực đề tài Nghiên < /b> cứu < /b> tạo < /b> kháng < /b> nguyên < /b> tái < /b> tổ < /b> hợp < /b> Staphylococcal < /b> enterotoxin < /b> B (SEB) phục vụ cho tạo < /b> kít phát nhanh ngộ độc < /b> thực phẩm độc < /b> tố tụ cầu vàng Trong trình nghiên < /b> cứu < /b> vừa ... vector biểu < /b> gen < /b> mã < /b> hóa < /b> cho kháng < /b> nguyên < /b> tái < /b> tổ < /b> hợp < /b> SEB gây đột < /b> biến < /b> loại độc < /b> tính - Biểu < /b> tinh protein SEB tế b o vi khuẩn E coli tạo < /b> nguyên < /b> liệu tạo < /b> kít phát vi khuẩn tụ cầu vàng thực phẩm Nội ... thống biểu < /b> tinh kháng < /b> nguyên < /b> tái < /b> tổ < /b> hợp < /b> staphylococcal < /b> enterotoxin < /b> B (SEB) gây đột < /b> biến < /b> loại độc < /b> tính phục vụ cho việc chế tạo < /b> kít phát vi khuẩn tụ cầu vàng (S aureus) thực phẩm Mục tiêu cụ thể...
  • 67
  • 383
  • 0


... tham gia thực đề tài Nghiên < /b> cứu < /b> tạo < /b> kháng < /b> nguyên < /b> tái < /b> tổ < /b> hợp < /b> Staphylococcal < /b> enterotoxin < /b> B (SEB) phục vụ cho tạo < /b> kít phát nhanh ngộ độc < /b> thực phẩm độc < /b> tố tụ cầu vàng Trong trình nghiên < /b> cứu < /b> vừa ... vector biểu < /b> gen < /b> mã < /b> hóa < /b> cho kháng < /b> nguyên < /b> tái < /b> tổ < /b> hợp < /b> SEB gây đột < /b> biến < /b> loại độc < /b> tính - Biểu < /b> tinh protein SEB tế b o vi khuẩn E coli tạo < /b> nguyên < /b> liệu tạo < /b> kít phát vi khuẩn tụ cầu vàng thực phẩm Nội ... thống biểu < /b> tinh kháng < /b> nguyên < /b> tái < /b> tổ < /b> hợp < /b> staphylococcal < /b> enterotoxin < /b> B (SEB) gây đột < /b> biến < /b> loại độc < /b> tính phục vụ cho việc chế tạo < /b> kít phát vi khuẩn tụ cầu vàng (S aureus) thực phẩm Mục tiêu cụ thể...
  • 67
  • 223
  • 0


... nặng Khả phát vi khuẩn cặp mồi cagA, thấp so với cặp mồi TH2 gien HP1125, cặp mồi TH2 phát hầu hết trường hợp nhiễm khuẩn HP, không phụ thuộc vào nhóm bệnh nhân chọn [5] Tuy nhiên, cặp mồi cagA sử ... sử dụng để phát vi khuẩn HP test bổ xung trường hợp, cặp mồi TH2 phát Helicobacter pylori gien HP1125 bị đột biến Vật liệu phương pháp Tiêu chuẩn chọn bệnh nhân Các bệnh nhân nhiễm H pylori theo ... mồi PCR nhằm phát vi khuẩn Helicobacter pylori (in press) Nguyễn Thị Nguyệt Nguyễn Thị Hồng Hạnh (2003) Tính nhậy tính đặc thù của hai cặp mồi PCR TH1 TH2 phát vi khuẩn Helicobacter pylori (in...
  • 3
  • 107
  • 1

Nghiên cứu xây dựng quy trình phát hiện nhanh virus cúm gia cầm a h5n1 trong mẫu bệnh phẩm bằng kỹ thuật multiplex reverse transcription polymerase chain reaction

Nghiên cứu xây dựng quy trình phát hiện nhanh virus cúm gia cầm a h5n1 trong mẫu bệnh phẩm bằng kỹ thuật multiplex reverse transcription polymerase chain reaction
... GTGACAGGATTGGTCTTGTCTT 158-139 55.8 DiagH5F AGTGATCAGATTTGCATTGGTTAC 46-69 54.6 DiagH5R GACCAAGAACTTTTGGGGATG 416-396 55.4 DiagN1F CCAGTTGGTTGACAATTGGAAT 503-524 54.5 DiagN1R GCATCAGGATAACAGGAGCA ... Influenza, 12th edn Ames, IA: Blackwell Publishing Professional 46 Takano R, Nidom CA, Kiso M, Muramoto Y, Yamada S, Sakai-Tagawa Y, Macken C, Kawaoka Y (2009), “Phylogenetic characterization of H5N1 ... H5 and H7 avian influenza viruses: amino acid sequence at the HA cleavage site as a marker of pathogenicity potential”, Avian Diseases, 40: 425437 45 Swayne DE and Halverson DA (2007), Diseases...
  • 11
  • 203
  • 0

Nghiên cứu xây dựng quy trình phát hiện nhanh virus cúm gia cầm A H5N1 trong mẫu bệnh phẩm bằng kỹ thuật multiplex reverse transcription polymerase chain reacti

Nghiên cứu xây dựng quy trình phát hiện nhanh virus cúm gia cầm A H5N1 trong mẫu bệnh phẩm bằng kỹ thuật multiplex reverse transcription polymerase chain reacti
... QUỐC GIA HÀ NỘI TRƯỜNG ĐẠI HỌC KHOA HỌC TỰ NHIÊN - TRẦN THỊ TÌNH NGHIÊN CỨU XÂY DỰNG QUY TRÌNH PHÁT HIỆN NHANH VIRUS CÚM GIA CẦM A/ H5N1 TRONG MẪU BỆNH PHẨM BẰNG KỸ THUẬT MULTIPLEX REVERSE ... dựng quy trình phát nhanh virus cúm gia cầm A/ H5N1 mẫu bệnh phẩm kỹ thuật Multiplex Reverse Transcription Polymerase Chain Reaction” Labo Trường Đại học Y Thái Bình với mục tiêu: Thiết kế l a chọn ... virus cúm A/ H5N1, sử dụng trình tự gen M, HA NA virus cúm gia cầm công bố Ngân hàng gen (GenBank) - Để nghiên cứu tối ưu h a phản ứng multiplex RT-PCR phát cúm A/ H5N1, sử dụng RNA virus cúm A/ H5N1...
  • 79
  • 177
  • 0

Nghiên cứu phương pháp phân tích phát hiện nhanh thuốc giả sử dụng các thiết bị phổ raman

Nghiên cứu phương pháp phân tích phát hiện nhanh thuốc giả sử dụng các thiết bị phổ raman
... sử dụng thiết bị phổ đại (Phổ Raman, Phổ hồng ngoại gần chuyển dạng Fourier phổ nhiễu xạ tia X-XRD)”, thực đề tài: Nghiên cứu phương pháp phân tích phát nhanh thuốc giả sử dụng thiết bị phổ Raman ... DƯỢC HÀ NỘI BÙI VIỆT PHƯƠNG NGHIÊN CỨU PHƯƠNG PHÁP PHÂN TÍCH PHÁT HIỆN NHANH THUỐC GIẢ SỬ DỤNG CÁC THIẾT BỊ PHỔ RAMAN LUẬN VĂN THẠC SỸ DƯỢC HỌC CHUYÊN NGÀNH: Kiểm nghiệm thuốc độc chất MÃ SỐ: ... quang phổ hấp thụ nguyên tử quang phổ hấp thụ phân tử: 18 Hình 1.6: Sơ đồ phân chia phương pháp quang phổ Các phương pháp phân tích quang học sử dụng là: - Phương pháp quang phổ hấp thụ UV-VIS ( phương...
  • 87
  • 155
  • 1

Nghiên cứu xây dựng quy trình phát hiện nhanh virus cúm gia cầm AH5N1 trong mẫu bệnh phẩm bằng kỹ thuật multiplex reverse transcription polymerase chain reaction

Nghiên cứu xây dựng quy trình phát hiện nhanh virus cúm gia cầm AH5N1 trong mẫu bệnh phẩm bằng kỹ thuật multiplex reverse transcription polymerase chain reaction
... dụng kỹ thuật chẩn đoán cúm A/H5N1 Chính vậy, thực Nghiên cứu xây dựng quy trình phát nhanh virus cúm gia cầm A/H5N1 mẫu bệnh phẩm kỹ thuật Multiplex Reverse Transcription Polymerase Chain Reaction ... đặc hiệu để phát kháng nguyên virus Người ta phát kháng nguyên virus trực tiếp từ mẫu bệnh phẩm số kỹ thuật khác nhau, nhiên kỹ thuật sử dụng phổ biến thời gian xét nghiệm nhanh là: Kỹ thuật miễn ... Ương + Mẫu bệnh phẩm thu thập từ gia cầm vụ dịch cúm: 30 mẫu bệnh phẩm thu thập từ gia cầm bị bệnh vụ dịch Đồng thời phát A/H5N1 mẫu phản ứng RT-PCR tối ưu để đánh giá độ tin cậy phản ứng multiplex...
  • 78
  • 77
  • 0

Nghiên cứu đặc điểm sinh trưởng, phát triển và một số biện pháp kỹ thuật trồng hoa lily tại ba bể-bắc Cạn

Nghiên cứu đặc điểm sinh trưởng, phát triển và một số biện pháp kỹ thuật trồng hoa lily tại ba bể-bắc Cạn
... NGUYỄN VĂN TẤP NGHIÊN CỨU ĐẶC ĐIỂM SINH TRƢỞNG, PHÁT TRIỂN VÀ MỘT SỐ BIỆN PHÁP KỸ THUẬT TRỒNG HOA LILY TẠI BA BỂ-BẮC KẠN CHUYÊN NGÀNH TRỒNG TRỌT MÃ SỐ: 60.62.01 LUẬN VĂN THẠC SĨ KHOA HỌC NÔNG NGHIỆP ... thời vụ trồng, mật độ trồng phù hợp chưa nghiên cứu cách hệ thống đầy đủ Chính vậy, triển khai đề tài: Nghiên cứu đặc điểm sinh trƣởng, phát triển số biện pháp kỹ thuật trồng hoa Lily Ba Bể-Bắc ... khoa học thực tiễn cho việc mở rộng sản xuất hoa Lily địa phương Mục đích Xác định khả thích ứng hoa Lily số biện pháp kỹ thuật sản xuất hoa Lily tỉnh Bắc Kạn Yêu cầu - Nghiên cứu đặc điểm sinh...
  • 115
  • 544
  • 1

Nghiên cứu khả năng sinh trưởng, phát triển và một số biện pháp kỹ thuật sản xuất hoa đồng tiền hà lan tại thái nguyên

Nghiên cứu khả năng sinh trưởng, phát triển và một số biện pháp kỹ thuật sản xuất hoa đồng tiền hà lan tại thái nguyên
... cõy hoa quanh nm, chng loi hoa a dng, phong phỳ cú nhiu ging hoa quý nh hoa lan, hoa trDo nhu cu dựng hoa v thng thc hoa ca ngi dõn ngy cng c nõng cao nờn thc t sn xut ta cng ó cú nhng ging hoa ... giỏ tr s dng ca cõy hoa ng tin Hoa ng tin thuc loi hoa lu niờn, hoa quanh nm, hoa p, cú rt nhiu hoa Cõy hoa cú th trng vn, ngoi rung, chu, s dng cm l hoa, cm chõm trờn bỏt, a Hoa ng tin c chia ... cỏc loi hoa chớnh nh: hoa Lan (Orchidacea), anthurium, hoa ng tin (Gerbera) Nhúm cú ngun gc ụn i nh: cỳc (Chysanthemum sp), layn (Gladiolus), hu c bit hoa lan l sn phm hoa nhit i, c sn hoa chõu...
  • 110
  • 329
  • 0

Nghiên cứu đặc điểm sinh trưởng phát triển và một số biện pháp kỹ thuật sản xuất chuối tiêu vùng đồng bằng sông hồng

Nghiên cứu đặc điểm sinh trưởng phát triển và một số biện pháp kỹ thuật sản xuất chuối tiêu vùng đồng bằng sông hồng
... i dung nghiên c u 36 3.3 Phương pháp nghiên c u 36 3.4 Ch tiêu theo dõi phương pháp xác ñ nh: 38 3.5 Phương pháp x lý s li u 39 K T QU NGHIÊN C U VÀ TH O LU N 40 4.1 Nghiên c u ñ c ñi m sinh trư ... 40 4.1 Nghiên c u ñ c ñi m sinh trư ng phát tri n c a gi ng chu i tiêu 4.1.1 Kh sinh trư ng phát tri n c a gi ng chu i nghiên c u Kh sinh trư ng phát tri n c a chu i th hi n m t s ch tiêu chi ... trình sinh trư ng phát tri n sinh dư ng ch tiêu sinh trư ng thân, không tăng thêm n a mà ñ t giá tr c c ñ i Khi nghiên c u kh sinh trư ng phát tri n c a gi ng ti n hành ñánh giá m t s ch tiêu sinh...
  • 104
  • 286
  • 1


... NGUYỄN VĂN TẤP NGHIÊN CỨU ĐẶC ĐIỂM SINH TRƢỞNG, PHÁT TRIỂN VÀ MỘT SỐ BIỆN PHÁP KỸ THUẬT TRỒNG HOA LILY TẠI BA BỂ-BẮC KẠN CHUYÊN NGÀNH TRỒNG TRỌT MÃ SỐ: 60.62.01 LUẬN VĂN THẠC SĨ KHOA HỌC NÔNG NGHIỆP ... vụ trồng, mật độ trồng phù hợp chưa nghiên cứu cách hệ thống đầy đủ Chính vậy, triển khai đề tài: Nghiên cứu đặc điểm sinh trƣởng, phát triển số biện pháp kỹ thuật trồng hoa Lily Ba Bể-Bắc Kạn" ... vật học số giống Lily trồng tỉnh Bắc Kạn - Nghiên cứu số biện pháp kỹ thuật trồng giống lily Sorbonne tỉnh Bắc Kạn - Xây dựng mô hình trồng hoa Lily tỉnh Bắc Kạn Số hóa Trung tâm Học liệu – Đại...
  • 115
  • 315
  • 0

Xem thêm

Từ khóa: quá trình tìm tòi và nghiên cứu tài liệu em đã phát hiện ra một số đề tài có liên quan tới vấn đề đang được nghiên cứu như saunghiên cứu tạo đột biến khử độc và biểu hiện gen mã hóa kháng nguyên tái tổ hợp staphylococcal enterotoxin b seb phục vụ cho việc chế tạo kít phát hiện tụ cầu vàng trong thực phẩmxây dựng phương pháp phát hiện aspergillus flavus sinh độc tố aflatoxin b1 trên ngũ cốc và thức ăn chăn nuôinghiên cứu đặc điểm lâm sàng hình ảnh não một số yếu tố nguy cơ và giá trị của ddimer trong chẩn đoán huyết khối tĩnh mạch nãobáo cáo nghiệm thu đề tài nhân nhanh một số dòng điều cao sản bằng phương pháp nuôi cấy quang tự dưỡng và lớp cành non và cây mầmnghiên cứu các giới hạn để phát triển bền vững tạo các điểm tham quan du lịch thuộc quần thể di tích huếnghiên cứu ứng dụng hệ thống phát hiện xâm nhậpnghiên cứu giải pháp hệ thống phát hiện xâm nhập đảm bảo an toàn thông tinque thử có phát hiện chửa ngoài dạ connghiệm pháp rượu ethanol đễ phát hiện có tình trạng tiêu sợi huyết của bệnh nhânphân tích kết quả đo sóng để phát hiện nhiễu tần sốluận văn nghiên cứu áp dụng sản xuất sạch hơn cho một số cơ sở sản xuất giấy tái sinh trên địa bàn quận bình tântìm hiểu các thiết bị điện trong nhà máy nhiệt điện đi sâu nghiên cứu quy trình vận hành an toàn cho một số thiết bị điệnluận văn nghiên cứu áp dụng sản xuất sạch hơn cho một số cơ sở sản xuất giấy tái sinh trên địa bàn quận bình tân tp hồ chí minhnghiên cứu biện pháp kỹ thuật canh tác cho một số giống chè nhập nội tại thái nguyênDạy học theo chủ đề tích hợp môn Ngữ văn 8 đạt giải III cấp huyện hay Tích hợp liên môn giáo dục công dân hóa học toán địa lý mĩ thuật âm nhạc qua văn bản Ôn dịch thuốc lá Học kì I Ngữ văn 8Thể dục 9 ky II CHUẨNĐề kiểm tra 1 tiết Toán 8 học kỳ I kèm đáp ánDẠY HỌC THEO CHỦ ĐỀ TÍCH HỢP MÔN cÔNG NGHỆ ĐẠT GIẢI III HUYỆN HAYBIÊN BẢN HỌP HÀNG THÁNG CHI ĐOÀN TRƯỜNG 2017Đảng bộ huyện mai sơn ( sơn la) lãnh đạo xóa đói giảm nghèo từ năm 1996 đến năm 2010Đảng bộ tỉnh hòa bình lãnh đạo xây dựng đời sống văn hóa từ năm 2006 đến năm 2015BAI TAP CAC CHU DIEM NGU PHAP TIENG ANH CHUANChính sách công nghệ xử lý xung đột môi trường giữa bệnh viện và cộng đồng dân cư sống xung quanh (nghiên cứu trường hợp bệnh viện bạch mai)Vấn đề tính dục trong thơ nôm của hồ xuân hương dưới góc nhìn văn hóachủ điểm ngữ pháp tiếng anh ôn thi 2016 2017 chuẩnGiáo trình động vật họcTÀI LIỆU ÔN THI TRUNG HỌC PHỔ THÔNG QUỐC GIA MÔN TIẾNG ANH HAYBài tập địa lý 9 ôn thi học sinh giỏiBÀI DỰ THI VẬN DỤNG KIẾN THỨC LIÊN MÔN ĐẠT GIẢI NHÌ TỈNH ĐỂ GIÚP MỌI NGƯỜI HIỂU ĐƯỢC TÁC HẠI CỦA VIỆC QUAN HỆ TÌNH DỤC Ở TUỔI VỊ THÀNH NIÊNTài liệu về bệnh ghẻ lớp y sỹTài liệu về bệnh giang mai lớp y sỹTài liệu về bệnh lậu học lớp y sỹTÀI LIỆU BỆNH CHÀM ECZEMATÀI LIỆU SINH LÝ HỌC CỦA DA