43922 explore the cell

báo cáo hóa học:" Use of a novel cell-based fusion reporter assay to explore the host range of human respiratory syncytial virus F protein" ppt

báo cáo hóa học:
... observed was attributable to the HRSV F protein Host range of HRSV-mediated fusion To determine the host range of HRSV F mediated fusion using the quantitative fusion assay 293T effector cells ... interpretation The assay described herein is a means of quantifying the fusion activity of the HRSV F protein This assay has multiple applications For example, this assay can be used as a means of studying ... 102 FL1-H 103 104 L138R A) Comparison of fusion activity of wild-type and a fusion peptide mutant of HRSV F Figure A) Comparison of fusion activity of wild-type and a fusion peptide mutant of HRSV...
  • 12
  • 124
  • 0

Tài liệu Báo cáo khoa học: The Saccharomyces cerevisiae vacuolar acid trehalase is targeted at the cell surface for its physiological function docx

Tài liệu Báo cáo khoa học: The Saccharomyces cerevisiae vacuolar acid trehalase is targeted at the cell surface for its physiological function docx
... ATTTCCTCATTCCAATAATG TTGAACTACGATCCAGAAGC GGATCCTCATTGAGAACAATTTCCTTGA GGATCCATCATGTTCTCATCATCATAATATG GGATCCGTTAAATATAATGCAGTGACGAAGATA GGATCCAAGTCAAACCTTGAGAAAGAACGA CACGGCATATTATGATGATGAGAACATGATGGATCTCG ... ATCCAAACTTATAATATTAAAAAAAGCGCTACTTATATGCATCATTTCATGAATTCGAGCTCGTTTAAAC GCACTAGTATGAAAAGAATAAGATCGCTTT GCCCCGGGATCATTGAGAACAATTTCC GCGGATCCGTATGACCACATTCTATACTGA GAGCCAATATCAAATCTGGTGGTAATCC GAGGAACAAAAATAGTACCGGTAATAAC ... TCAGGAACATCGTATGGGTA CATTATTGGAATGAGGAAA ATGACGTTCCAGATTACGCT AAAAGAATAAGATCGCTT TTACCGGTACTATTTTTGTTCCTCAAACTAGGAG GTATGACCACATTCTATACTGAGAAGAGTGCCTATATAAATCATCGTCAGGTAAAGAGCCCCATTATCTT GGGACGTCATACGGATAGCCCGCATAGTCAGGAACATCGTATGGGTACATGGGTTTTTTCTCCTTGACG...
  • 15
  • 174
  • 0

Information Technology for Managers - Explore the Facebook''s service and its successfull

Information Technology for Managers - Explore the Facebook''s service and its successfull
... Timeline - Graph Search - Messages Photos and Video - Groups - Event - Pages - Platform - Apps Social - and the sharing activity of their friends A new kind of profile that lets people organizes and ... LOWER Sales And Marketing Costs In Q2 Retrieved from http://www.businessinsider.com/facebookgot-more-revenue-on-lower-sales -and- marketing-costs-in-q 2-2 0127#ixzz2Vjq5yG8P Jonathan Strickland (2013) ... http://marketingland.com/facebook-q3-earnings-36percent-ad-revenue-growth-14-percent-from-mobile-24846 10 Michael Arrington (2010) The Age Of Facebook Retrieved from http://techcrunch.com/2010/04/25 /the- age-of-facebook/ 11 Socialmediainfluence.com...
  • 27
  • 185
  • 0

Báo cáo khoa học: Use of lithium and SB-415286 to explore the role of glycogen synthase kinase-3 in the regulation of glucose transport and glycogen synthase pdf

Báo cáo khoa học: Use of lithium and SB-415286 to explore the role of glycogen synthase kinase-3 in the regulation of glucose transport and glycogen synthase pdf
... raise the possibility that GSK3 may help to coordinate increases in glucose uptake and glycogen synthesis allowing for more effective ÔchannellingÕ of glucose into glycogen in response to insulin ... Effects of insulin, Li and SB-415286 on signalling elements implicated in the regulation of GSK3 and GS To further understand the effects of Li and SB-415286 on cell signalling events we assessed their ... by insulin Regulation of GS activity To establish the importance of GSK3 inhibition on GS activity we monitored the effects of insulin, Li, SB-415286 and wortmannin (a PI3K inhibitor) on the incorporation...
  • 10
  • 255
  • 0

Báo cáo khoa học: Plant nuclear proteomics – inside the cell maestro pdf

Báo cáo khoa học: Plant nuclear proteomics – inside the cell maestro pdf
... focuses on plant nucleus proteomes, as the proteomics of whole plants [ 8–1 3] has been previously reviewed Furthermore, we will here discuss the uniqueness of the nucleus within the cell and the problems ... regulation and signalling Thus, in summary, the data have further supported the role of the plant nucleus as the major cellular regulator, in the mould of a cell maestro Not only will A thaliana researchers ... involved in the overall cellular estate than imagined The data presented on the latest attempts to cover the nuclear proteome of several plant species are of great value Besides the expected, there...
  • 13
  • 84
  • 0

Báo cáo khoa học: Site-specific phosphorylation of MCM4 during the cell cycle in mammalian cells pot

Báo cáo khoa học: Site-specific phosphorylation of MCM4 during the cell cycle in mammalian cells pot
... HeLa cell cycle in a site-specific manner Cyclin-dependent protein kinase is involved in the phosphorylation of MCM4 To determine which kinase is involved in the phosphorylation of MCM4 in phases ... CDK2 during interphase in human HeLa cells Changes in the phosphorylation level during the cell cycle and the nuclear localization of phosphorylated MCM4 suggest that MCM4 phosphorylated at these ... antiphosphoMCM4 sera recognized the retarded MCM4 prepared from cells in the M phase, indicating that these sites are indeed phosphorylated in the M phase in HeLa cells We classified the mode of phosphorylation...
  • 16
  • 99
  • 0

Báo cáo khoa học: Injection of poly(b-L-malate) into the plasmodium of Physarum polycephalum shortens the cell cycle and increases the growth rate pot

Báo cáo khoa học: Injection of poly(b-L-malate) into the plasmodium of Physarum polycephalum shortens the cell cycle and increases the growth rate pot
... increases the growth rate and shortens the duration of the cell cycle is the polymer-inherent isosterism of the carboxylates with the array of phosphates in nucleic acids and, consequently, the ... the mechanism(s) underlying the increase in the growth rate and the shortening of the cell cycle might be related to the ability of PMLA to form complexes with nucleic acid binding proteins and ... levels of PMLA induced a strain specific enhancement of cell growth and an equal (between strains) shortening of the cell cycle Materials and methods Strains and materials The following strains of...
  • 7
  • 107
  • 0

Báo cáo Y học: A polymer with a backbone of 3-deoxy-D-glycero -D-galacto -non-2ulopyranosonic acid, a teichuronic acid, and a b-glucosylated ribitol teichoic acid in the cell wall of plant pathogenic Streptomyces sp. VKM Ac-2124 pdf

Báo cáo Y học: A polymer with a backbone of 3-deoxy-D-glycero -D-galacto -non-2ulopyranosonic acid, a teichuronic acid, and a b-glucosylated ribitol teichoic acid in the cell wall of plant pathogenic Streptomyces sp. VKM Ac-2124 pdf
... that the Kdn-containing polymer, along with teichuronic and teichoic acids is a constituent of the cell wall of plant pathogenic strain Streptomyces sp VKM Ac-2124, which is phylogenetically the ... of the total cell wall preparation was determined by its transformation in 2-octyl glycoside and by comparison of the derivative obtained with standard samples of (S+ )and (R-)-2-octyl glucopyranosides ... bootstrap analysis of the sequence data with the same software To evaluate the pathogenic activity of the strain, the aseptically cultured potato microtubers in vitro were used as described by Lawrence...
  • 6
  • 157
  • 0

Báo cáo khoa học: Dynamic association of MLL1, H3K4 trimethylation with chromatin and Hox gene expression during the cell cycle ppt

Báo cáo khoa học: Dynamic association of MLL1, H3K4 trimethylation with chromatin and Hox gene expression during the cell cycle ppt
... occupancy of MLL1, H3K4 trimethylation and RNAP II with Hox gene expression indicates the critical roles of MLL1 and H3K4 trimethylation in differential Hox gene expression during the cell cycle ... at the beginning of the S phase (0 h), and these marks were attenuated for the rest of the cell cycle (10 and 20 h), correlating with the expression of the gene (Fig 6C,D) The correlation of ... differentially expressed during the cell cycle We analyzed the expression profiles of three Hox genes, HoxA5, HoxA7 and HoxA10 HoxA5 is expressed at a low level at the beginning of the S phase and increases...
  • 12
  • 97
  • 0

INTEGRATING RESEARCH AND EDUCATION BIOCOMPLEXITY INVESTIGATORS EXPLORE THE POSSIBILITIES ppt

INTEGRATING RESEARCH AND EDUCATION BIOCOMPLEXITY INVESTIGATORS EXPLORE THE POSSIBILITIES ppt
... what they believe are the core principles of research Attendees INTEGRATING RESEARCH AND EDUCATION discussed their ideas in small groups and then offered their answers to the audience at large Themes ... expanded to include the students and/ or the audience Researchers should respect the recipients of their knowledge, what these recipients know already, and the diversity of their backgrounds and ... INTEGRATING RESEARCH AND EDUCATION BIOCOMPLEXITY INVESTIGATORS EXPLORE THE POSSIBILITIES SUMMARY OF A WORKSHOP Bridget K B Avila Board on Life Sciences Division on Earth and Life Studies THE...
  • 91
  • 51
  • 0

Báo cáo khoa học: Collective behavior in gene regulation: The cell is an oscillator, the cell cycle a developmental process doc

Báo cáo khoa học: Collective behavior in gene regulation: The cell is an oscillator, the cell cycle a developmental process doc
... housekeeping genes as normalizing standards is a time-honored practice in PCR and other amplification assays Warrington et al [36] addressed this question in an analysis of human adult and fetal tissues ... et al amplitude of the oscillation Inherent in many of the starting points for analysis of microarray data is the idea that the underlying process involves cells that exist at a steady state and ... replicating and dividing with the minimal generation times Kinetically, the yeast stochastic tissue and a mammalian tissue such as the epithelial cells of the gastro-intestinal tract are similar...
  • 13
  • 64
  • 0

Báo cáo khoa học: Inhibition of the D-alanine:D-alanyl carrier protein ligase from Bacillus subtilis increases the bacterium’s susceptibility to antibiotics that target the cell wall potx

Báo cáo khoa học: Inhibition of the D-alanine:D-alanyl carrier protein ligase from Bacillus subtilis increases the bacterium’s susceptibility to antibiotics that target the cell wall potx
... an inhibitor To test if the inhibitor was able to penetrate the cell wall to reach its target DltA, we investigated changes in the growth rates of the Gram positive wild type strains B subtilis ... the the B subtilis DltA-deletion mutant This DltA-mutant was used to exclude the possibility that may act as an inhibitor in pathways other than that of DltA We also test the susceptibility of ... Discussion The biosynthesis of d-alanyl-lipoteichoic acid requires four proteins that are encoded by the dlt operon [5] The synthesis starts with the selection of the d-Ala by the 57 kDa d-Ala-d-Ala carrier...
  • 11
  • 130
  • 0

Báo cáo khoa học: Pleiotrophin inhibits HIV infection by binding the cell surface-expressed nucleolin docx

Báo cáo khoa học: Pleiotrophin inhibits HIV infection by binding the cell surface-expressed nucleolin docx
... PTN inhibits HIV infection by binding the cell- surface expressed nucleolin leading to the inhibition of HIV- attachment to the cell surface PTN binding to cells involves high and low affinitybinding ... Inhibition of HIV- infection by PTN We investigated the inhibitory effect of PTN on HIV infection by using the experimental model of HeLa P4 or HeLa P4C5 cells HIV entry and replication in these cells ... Fig The effect of the nucleolin binding molecules on the binding of PTN to the low and high affinity -binding site (A) Inhibitory effect of HB-19 on the binding of the 125 I-labeled PTN to the...
  • 14
  • 123
  • 0

Xem thêm

Nạp tiền Tải lên
Đăng ký
Đăng nhập