21981 pronunciation of and i

Tài liệu Báo cáo khoa học: Comparative studies of endonuclease I from cold-adapted Vibrio salmonicida and mesophilic Vibrio cholerae docx

Tài liệu Báo cáo khoa học: Comparative studies of endonuclease I from cold-adapted Vibrio salmonicida and mesophilic Vibrio cholerae docx
... and plasmid were analyzed using linearized pBAD ⁄ gIII plasmid, linearized and denatured plasmid and intact plasmid The pBAD ⁄ gIII plasmid was linearized using SalI and denatured by incubation ... Biochemical Adaptation Princeton University Press, Princeton, NJ Wu SI, Lo SK, Shao CP, Tsai HW & Hor LI (2001) Cloning and characterization of a periplasmic nuclease of Vibrio vulnificus and its ... constitutively expressed in V vulnificus [5] and Erwinia chrysanthemi [18] Endonuclease I from V salmonicida and V cholerae Here we report the cloning, expression and purification of the endonuclease I...
  • 12
  • 249
  • 0

Tài liệu Báo cáo khoa học: Distribution of class I, III and IV alcohol dehydrogenase mRNAs in the adult rat, mouse and human brain ppt

Tài liệu Báo cáo khoa học: Distribution of class I, III and IV alcohol dehydrogenase mRNAs in the adult rat, mouse and human brain ppt
... involvement of ADH1 and ADH4 in ethanol oxidation in brain tissue Regarding retinoid metabolism in the adult brain, enzymes other than ADH4 must be active, because in vivo and in vitro data indicate ... Table Distribution of the three ADH classes in adult rat, mouse and human brain tissue The presence of specific signal is shown by +, strong presence by ++ and absence by – Rat Mouse Human Brain ... ADH3 mRNA in the granular layer of human cerebellum Table compiles our findings in adult brain tissue of all three species Discussion The distribution of ADHs in the brain is of particular interest...
  • 11
  • 272
  • 0

Tài liệu Báo cáo khoa học: Identi®cation and properties of type I-signal peptidases of Bacillus amyloliquefaciens doc

Tài liệu Báo cáo khoa học: Identi®cation and properties of type I-signal peptidases of Bacillus amyloliquefaciens doc
... Cloning of sipU Cloning of sipU Cloning of sipU Cloning of sipU Cloning of sipU Cloning of sipU Cloning of sipU Cloning of sipU Cloning of sipV Cloning of sipV Cloning of sipV Cloning of sipV ... Cloning of sipV Cloning of sipV Cloning of sipV Construction of pOpacVh Construction of pOpacVh Cloning of sipW Cloning of sipW Cloning of sipW Cloning of sipW Cloning of sipW Cloning of sipW ... Construction of pOpacWh Construction of pOpacWh Construction of pOpacSh Construction of pOpacSh Construction of pOpacTh Construction of pOpacTh Construction of pOpacBh Construction of pOpacBh Construction...
  • 12
  • 211
  • 0

Báo cáo Y học: Properties of group I allergens from grass pollen and their relation to cathepsin B, a member of the C1 family of cysteine proteinases pdf

Báo cáo Y học: Properties of group I allergens from grass pollen and their relation to cathepsin B, a member of the C1 family of cysteine proteinases pdf
... resistant to cleavage with chymotrypsin, trypsin, papain, or pronase Protozoan parasites of the genus Giardia are one of the earliest lineages of eukaryotic cells, and the Giardia protease is the ... expressed at a high level (data not shown) DISCUSSION Computer analysis of b-expansins reveals significant similarity to cathepsins, which are members of the C1 family of cysteine proteinases WU-BLAST ... proteinases of G lamblia and G gallus All Cys and Trp residues are absolutely conserved in a- expansins and b-expansins as well as in the C1 cysteine proteinases Other highly conserved amino acids of cathepsin...
  • 10
  • 206
  • 0

Báo cáo khoa học: Effects of salt on the kinetics and thermodynamic stability of endonuclease I from Vibrio salmonicida and Vibrio cholerae potx

Báo cáo khoa học: Effects of salt on the kinetics and thermodynamic stability of endonuclease I from Vibrio salmonicida and Vibrio cholerae potx
... stoichiometries of participation of water, cations and anions in specific and non-specific binding of lac repressor to DNA Possible thermodynamic origins of the ‘‘glutamate effect’’ on protein–DNA ... function optimally Effects of mutations The point mutations are not in the immediate vicinity of the active site situated at the bottom of the positively charged pocket, but are still likely ... ⁄ Km in the region of 108 s)1Æm)1) shows that the reaction is nearly diffusion controlled, suggesting that the rate-limiting step is either substrate binding or dissociation As all mutations affect...
  • 13
  • 168
  • 0

Báo cáo khoa học: Knock-out of the chloroplast-encoded PSI-J subunit of photosystem I in Nicotiana tabacum PSI-J is required for efficient electron transfer and stable accumulation of photosystem I pot

Báo cáo khoa học: Knock-out of the chloroplast-encoded PSI-J subunit of photosystem I in Nicotiana tabacum PSI-J is required for efficient electron transfer and stable accumulation of photosystem I pot
... and the other for integrity and stabilization of a luminal domain involving at least PSI-N and the N-terminal part of PSI-F which is required for efficient electron transfer Fig Alignment of PSI-J ... 2), suggesting that the PSI antenna size is unaffected by the elimination of PSI-J and furthermore ruling out the possibility that PSI-J is strictly required for binding of any of the Lhca antenna ... PSI-F and PSI-N The absence of PSI-J might affect the conformation of PSI-F, which, in turn, changes the binding of PSI-N PSI-F provides part of the Pc-binding site in plants [16], and it is known...
  • 13
  • 166
  • 0

Báo cáo khoa học: Comparative biochemical and functional studies of family I soluble inorganic pyrophosphatases from photosynthetic bacteria potx

Báo cáo khoa học: Comparative biochemical and functional studies of family I soluble inorganic pyrophosphatases from photosynthetic bacteria potx
... rans phil us Vibrio cholerae Escherichia coli Rickettsia prowazekii Sulfolobus acidocaldarius Aquifex aeolicus Helicobacter pylori B ac Prokaryotic Family I sPPases * Neisseria meningitidis 925 ... (MDLSRIPPQP KAGILNVLIE IPAG), and Rhodop viridis (MRIDA IDXA), and that of Mi aeruginosa NIES-44 (MDL SRKPAQP IPGLKNVLVE TAGSINIT) [16], show a high degree of similarity with other cytosolic sPPases ... biotic and abiotic stress conditions [13,15] This work shows that cyanobacterial strains as well as diverse anoxygenic photosynthetic bacteria possess family I sPPases with different catalytic...
  • 12
  • 164
  • 0

Báo cáo khoa học: Characterization of D-amino-acid-containing excitatory conotoxins and redefinition of the I-conotoxin superfamily pot

Báo cáo khoa học: Characterization of D-amino-acid-containing excitatory conotoxins and redefinition of the I-conotoxin superfamily pot
... wells and At the same time, the activity of the muscle was recorded with a pair of electrodes: one electrode was located in the middle, and the other at one end, of the trough Each pair of recording ... from amino-acid sequences Purification and synthesis of I -superfamily conotoxins D-Amino The excitatory peptides r11b and r11c were purified from the venom of the fish-hunting species Conus radiatus ... assay r11b, r11c and their l isomers In the case of r11b, a fivefold difference was observed in potencies of the d-Phe44 and l-Phe44 forms The estimate is based on comparison of the threshold dose...
  • 11
  • 153
  • 0

Báo cáo khoa học: Making sense of G-quadruplex and i-motif functions in oncogene promoters pot

Báo cáo khoa học: Making sense of G-quadruplex and i-motif functions in oncogene promoters pot
... contaminating protein that is either an accessory protein or a minor recombinant protein [34] Studies show that an R88A mutation (arginine to alanine) in the nucleotidebinding site eliminates binding ... G-quadruplex and i-motif in oncogene promoters T A Brooks et al enrichment of these motifs in oncogenes Consistent with this finding, G-quadruplex motifs within several oncogene promoters ... NM23-H2 3′ 5′ 5′ 3′ OFF Fig Cartoon showing the involvement of NM23-H2, nucleolin and a G-quadruplex- interactive compound in modulating the activation and silencing of the NHE III1 in the c-Myc promoter...
  • 11
  • 157
  • 0

Báo cáo khoa học: A comparative study of type I and type II tryparedoxin peroxidases in Leishmania major pot

Báo cáo khoa học: A comparative study of type I and type II tryparedoxin peroxidases in Leishmania major pot
... TATATCATATGTCTATCTACGACTTCAAGGTC ATATAGGATCCTCACGATTGAGTGCTTGG ATATATCATATGTCCGGTGTCGCAAAG ATATAGGATCCTTACTCGTCTCTCCACGG ATATATCATATGTCCTGCGGTAACGCC ATATAGGATCCTTACTGCTTGCTGAAGTATC CAACGTAGCCAGCAAGGCCGGCTTCACCAAGGGCG ... Heterologous priming-boosting with DNA and modied vaccinia virus Ankara expressing tryparedoxin peroxidase promotes long-term memory against Leishmania major in susceptible BALB c mice Infect Immun 75, ... min) and protein content in the supernatants determined by the Bradford protein assay (Bio-Rad) using BSA as standard L major protein extracts Comparison of L major tryparedoxin peroxidases in...
  • 16
  • 168
  • 0

Báo cáo khoa học: Signalling and regulation of collagen I synthesis by ET-1 and TGF-b1 doc

Báo cáo khoa học: Signalling and regulation of collagen I synthesis by ET-1 and TGF-b1 doc
... values TGF-b1 signalling was affected similarly, with no effect by inhibiting PLC-b (Fig 5A), strong down -regulation of collagen I levels after inhibition of PC-PLC (Fig 5B), and similar collagen I ... subunit of Gai [45] was inhibited specifically by U73122 [46] Inhibiting PLC-b by U73122 did not alter ET-1- induced collagen I synthesis, nor did it influence basal or TGF-b1- stimulated collagen I ... investigations should reveal if ET-1 elicits induced collagen I synthesis solely via induction of CTGF or via additional mechanisms as it is the case for TGF-b1 stimulation [2,55] In contrast to ET-1, ...
  • 13
  • 197
  • 0

Báo cáo hóa học: " Simultaneous circulation of genotypes I and III of dengue virus 3 in Colombia" docx

Báo cáo hóa học:
... Ecuador00b I I I I I I I I I I I I I I I I I I I I I I (V)b I (V)b I (V)b II II II II II II II II II II II II II II II III III III III III III III III III III III III III III III III III III III III 1998 ... Asia/S.Pacific (I) India (III) India (III) India (III) India (III) India (III) India (III) India (III) India (III) India (III) India (III) India (III) India (III) India (III) India (III) India ... (III) India (III) India (III) India (III) India (III) India (III) India (III) India (III) India (III) India (III) *Code in Laboratorio de Virologia, INS repository (Instituto Nacional de Salud,...
  • 10
  • 118
  • 0

Financial Audit of the Department of Agriculture A Report to the Governor and the Legislature of the State of Hawai`i Report No. 05-02 April 2005_part1 docx

Financial Audit of the Department of Agriculture A Report to the Governor and the Legislature of the State of Hawai`i Report No. 05-02 April 2005_part1 docx
... The Auditor State of Hawai`i OVERVIEW Financial Audit of the Department of Agriculture Report No 05-02, April 2005 Summary The Office of the Auditor and the certified public accounting firm of ... Grant Thornton LLP conducted a financial audit of the Department of Agriculture, State of Hawai`i, for the fiscal year July 1, 2003 to June 30, 2004 The audit examined the financial records and ... is a report of the financial audit of the Department of Agriculture, State of Hawai`i, for the fiscal year July 1, 2003 to June 30, 2004 The audit was conducted pursuant to Section 23-4, Hawai`i...
  • 11
  • 79
  • 0

Xem thêm

Từ khóa: Xây dựng bộ tiêu chí đánh giá chương trình đào tạo tiên tiến khối ngành kỹ thuật ở việt namSử dụng phương pháp nêu vấn đề trong dạy học môn GDCD lớp 11 ở một số trường THPT, tỉnh thái nguyênQuản lý hoạt động chăm sóc giáo dục trẻ mẫu giáo lớn theo bộ chuẩn phát triển trẻ em 5 tuổi các trường mầm non huyện bình giang tỉnh hải dươngHoàn thiện công tác kiểm soát chi thường xuyên ngân sách nhà nước tại kho bạc nhà nước thị xã phúc yên, tỉnh vĩnh phúcXây dựng hệ thống bài tập nhằm phát triển năng lực tạo lập văn bản miêu tả cho học sinh lớp 6Vận dụng phương pháp nêu vấn đề và sử dụng tình huống trong dạy học lý luận chính trị tại trung tâm bồi dưỡng chính trị huyện vũ thư, tỉnh thái bìnhĐánh giá đặc điểm, điều kiện môi trường sinh thái vùng bán ngập lòng hồ thủy điện sơn laNâng cao năng lực cạnh tranh của ngân hàng TMCP đông nam á chi nhánh thái nguyênXây dựng và tổ chức dạy học một số chủ đề tích hợp kiến thức khoa học tự nhiên ở trường trung học cơ sởBiểu diễn số nguyên thành tổng hai bình phương của số nguyênNghiên cứu một số đặc điểm dịch tễ bệnh sán lá gan ở trâu, bò nuôi tại tỉnh lạng sơn và đề xuất biện pháp phòng trịGiải pháp phát triển bền vững khu công nghiệp yên bình, tỉnh thái nguyênCác giải pháp thu hút vốn đầu tư trực tiếp nước ngoài vào thành phố sông công tỉnh thái nguyênTăng cường công tác quản lý đất đai trên địa bàn tỉnh lai châuTổng hợp 25 bộ đề thi Toán THPT quốc gia (Có Đáp Án Chi Tiết)Nghiên cứu ảnh hưởng của một số tổ hợp phân bón đến sinh trưởng, phát triển và năng suất của giống đậu tương đt26 trong vụ hè thu và vụ xuân tại thái nguyênHình thành kĩ năng sử dụng bản đồ trong dạy học địa lí lớp 11 – trung học phổ thôngNghiên cứu đặc điểm và chuyển gen GmDREB2 nhằm cải thiện tính chịu hạn của cây đậu tương (glycine max (l ) merrillNghiên cứu khả năng phân giải chất thải hữu cơ của giun quế tại thành phố bắc kạnNâng cao quản lý hoạt động tín dụng tại chi nhánh ngân hàng chính sách xã hội tỉnh vĩnh phúc
Nạp tiền Tải lên
Đăng ký
Đăng nhập