21981 pronunciation of and i

Tài liệu Báo cáo khoa học: Comparative studies of endonuclease I from cold-adapted Vibrio salmonicida and mesophilic Vibrio cholerae docx

Tài liệu Báo cáo khoa học: Comparative studies of endonuclease I from cold-adapted Vibrio salmonicida and mesophilic Vibrio cholerae docx
... and plasmid were analyzed using linearized pBAD ⁄ gIII plasmid, linearized and denatured plasmid and intact plasmid The pBAD ⁄ gIII plasmid was linearized using SalI and denatured by incubation ... Biochemical Adaptation Princeton University Press, Princeton, NJ Wu SI, Lo SK, Shao CP, Tsai HW & Hor LI (2001) Cloning and characterization of a periplasmic nuclease of Vibrio vulnificus and its ... constitutively expressed in V vulnificus [5] and Erwinia chrysanthemi [18] Endonuclease I from V salmonicida and V cholerae Here we report the cloning, expression and purification of the endonuclease I...
  • 12
  • 202
  • 0

Tài liệu Báo cáo khoa học: Distribution of class I, III and IV alcohol dehydrogenase mRNAs in the adult rat, mouse and human brain ppt

Tài liệu Báo cáo khoa học: Distribution of class I, III and IV alcohol dehydrogenase mRNAs in the adult rat, mouse and human brain ppt
... involvement of ADH1 and ADH4 in ethanol oxidation in brain tissue Regarding retinoid metabolism in the adult brain, enzymes other than ADH4 must be active, because in vivo and in vitro data indicate ... Table Distribution of the three ADH classes in adult rat, mouse and human brain tissue The presence of specific signal is shown by +, strong presence by ++ and absence by – Rat Mouse Human Brain ... ADH3 mRNA in the granular layer of human cerebellum Table compiles our findings in adult brain tissue of all three species Discussion The distribution of ADHs in the brain is of particular interest...
  • 11
  • 223
  • 0

Tài liệu Báo cáo khoa học: Identi®cation and properties of type I-signal peptidases of Bacillus amyloliquefaciens doc

Tài liệu Báo cáo khoa học: Identi®cation and properties of type I-signal peptidases of Bacillus amyloliquefaciens doc
... Cloning of sipU Cloning of sipU Cloning of sipU Cloning of sipU Cloning of sipU Cloning of sipU Cloning of sipU Cloning of sipU Cloning of sipV Cloning of sipV Cloning of sipV Cloning of sipV ... Cloning of sipV Cloning of sipV Cloning of sipV Construction of pOpacVh Construction of pOpacVh Cloning of sipW Cloning of sipW Cloning of sipW Cloning of sipW Cloning of sipW Cloning of sipW ... Construction of pOpacWh Construction of pOpacWh Construction of pOpacSh Construction of pOpacSh Construction of pOpacTh Construction of pOpacTh Construction of pOpacBh Construction of pOpacBh Construction...
  • 12
  • 164
  • 0

Báo cáo Y học: Properties of group I allergens from grass pollen and their relation to cathepsin B, a member of the C1 family of cysteine proteinases pdf

Báo cáo Y học: Properties of group I allergens from grass pollen and their relation to cathepsin B, a member of the C1 family of cysteine proteinases pdf
... resistant to cleavage with chymotrypsin, trypsin, papain, or pronase Protozoan parasites of the genus Giardia are one of the earliest lineages of eukaryotic cells, and the Giardia protease is the ... expressed at a high level (data not shown) DISCUSSION Computer analysis of b-expansins reveals significant similarity to cathepsins, which are members of the C1 family of cysteine proteinases WU-BLAST ... proteinases of G lamblia and G gallus All Cys and Trp residues are absolutely conserved in a- expansins and b-expansins as well as in the C1 cysteine proteinases Other highly conserved amino acids of cathepsin...
  • 10
  • 162
  • 0

Báo cáo khoa học: Effects of salt on the kinetics and thermodynamic stability of endonuclease I from Vibrio salmonicida and Vibrio cholerae potx

Báo cáo khoa học: Effects of salt on the kinetics and thermodynamic stability of endonuclease I from Vibrio salmonicida and Vibrio cholerae potx
... stoichiometries of participation of water, cations and anions in specific and non-specific binding of lac repressor to DNA Possible thermodynamic origins of the ‘‘glutamate effect’’ on protein–DNA ... function optimally Effects of mutations The point mutations are not in the immediate vicinity of the active site situated at the bottom of the positively charged pocket, but are still likely ... ⁄ Km in the region of 108 s)1Æm)1) shows that the reaction is nearly diffusion controlled, suggesting that the rate-limiting step is either substrate binding or dissociation As all mutations affect...
  • 13
  • 137
  • 0

Báo cáo khoa học: Knock-out of the chloroplast-encoded PSI-J subunit of photosystem I in Nicotiana tabacum PSI-J is required for efficient electron transfer and stable accumulation of photosystem I pot

Báo cáo khoa học: Knock-out of the chloroplast-encoded PSI-J subunit of photosystem I in Nicotiana tabacum PSI-J is required for efficient electron transfer and stable accumulation of photosystem I pot
... and the other for integrity and stabilization of a luminal domain involving at least PSI-N and the N-terminal part of PSI-F which is required for efficient electron transfer Fig Alignment of PSI-J ... 2), suggesting that the PSI antenna size is unaffected by the elimination of PSI-J and furthermore ruling out the possibility that PSI-J is strictly required for binding of any of the Lhca antenna ... PSI-F and PSI-N The absence of PSI-J might affect the conformation of PSI-F, which, in turn, changes the binding of PSI-N PSI-F provides part of the Pc-binding site in plants [16], and it is known...
  • 13
  • 136
  • 0

Báo cáo khoa học: Comparative biochemical and functional studies of family I soluble inorganic pyrophosphatases from photosynthetic bacteria potx

Báo cáo khoa học: Comparative biochemical and functional studies of family I soluble inorganic pyrophosphatases from photosynthetic bacteria potx
... rans phil us Vibrio cholerae Escherichia coli Rickettsia prowazekii Sulfolobus acidocaldarius Aquifex aeolicus Helicobacter pylori B ac Prokaryotic Family I sPPases * Neisseria meningitidis 925 ... (MDLSRIPPQP KAGILNVLIE IPAG), and Rhodop viridis (MRIDA IDXA), and that of Mi aeruginosa NIES-44 (MDL SRKPAQP IPGLKNVLVE TAGSINIT) [16], show a high degree of similarity with other cytosolic sPPases ... biotic and abiotic stress conditions [13,15] This work shows that cyanobacterial strains as well as diverse anoxygenic photosynthetic bacteria possess family I sPPases with different catalytic...
  • 12
  • 141
  • 0

Báo cáo khoa học: Characterization of D-amino-acid-containing excitatory conotoxins and redefinition of the I-conotoxin superfamily pot

Báo cáo khoa học: Characterization of D-amino-acid-containing excitatory conotoxins and redefinition of the I-conotoxin superfamily pot
... wells and At the same time, the activity of the muscle was recorded with a pair of electrodes: one electrode was located in the middle, and the other at one end, of the trough Each pair of recording ... from amino-acid sequences Purification and synthesis of I -superfamily conotoxins D-Amino The excitatory peptides r11b and r11c were purified from the venom of the fish-hunting species Conus radiatus ... assay r11b, r11c and their l isomers In the case of r11b, a fivefold difference was observed in potencies of the d-Phe44 and l-Phe44 forms The estimate is based on comparison of the threshold dose...
  • 11
  • 129
  • 0

Báo cáo khoa học: Making sense of G-quadruplex and i-motif functions in oncogene promoters pot

Báo cáo khoa học: Making sense of G-quadruplex and i-motif functions in oncogene promoters pot
... contaminating protein that is either an accessory protein or a minor recombinant protein [34] Studies show that an R88A mutation (arginine to alanine) in the nucleotidebinding site eliminates binding ... G-quadruplex and i-motif in oncogene promoters T A Brooks et al enrichment of these motifs in oncogenes Consistent with this finding, G-quadruplex motifs within several oncogene promoters ... NM23-H2 3′ 5′ 5′ 3′ OFF Fig Cartoon showing the involvement of NM23-H2, nucleolin and a G-quadruplex- interactive compound in modulating the activation and silencing of the NHE III1 in the c-Myc promoter...
  • 11
  • 117
  • 0

Báo cáo khoa học: A comparative study of type I and type II tryparedoxin peroxidases in Leishmania major pot

Báo cáo khoa học: A comparative study of type I and type II tryparedoxin peroxidases in Leishmania major pot
... TATATCATATGTCTATCTACGACTTCAAGGTC ATATAGGATCCTCACGATTGAGTGCTTGG ATATATCATATGTCCGGTGTCGCAAAG ATATAGGATCCTTACTCGTCTCTCCACGG ATATATCATATGTCCTGCGGTAACGCC ATATAGGATCCTTACTGCTTGCTGAAGTATC CAACGTAGCCAGCAAGGCCGGCTTCACCAAGGGCG ... Heterologous priming-boosting with DNA and modied vaccinia virus Ankara expressing tryparedoxin peroxidase promotes long-term memory against Leishmania major in susceptible BALB c mice Infect Immun 75, ... min) and protein content in the supernatants determined by the Bradford protein assay (Bio-Rad) using BSA as standard L major protein extracts Comparison of L major tryparedoxin peroxidases in...
  • 16
  • 127
  • 0

Báo cáo khoa học: Signalling and regulation of collagen I synthesis by ET-1 and TGF-b1 doc

Báo cáo khoa học: Signalling and regulation of collagen I synthesis by ET-1 and TGF-b1 doc
... values TGF-b1 signalling was affected similarly, with no effect by inhibiting PLC-b (Fig 5A), strong down -regulation of collagen I levels after inhibition of PC-PLC (Fig 5B), and similar collagen I ... subunit of Gai [45] was inhibited specifically by U73122 [46] Inhibiting PLC-b by U73122 did not alter ET-1- induced collagen I synthesis, nor did it influence basal or TGF-b1- stimulated collagen I ... investigations should reveal if ET-1 elicits induced collagen I synthesis solely via induction of CTGF or via additional mechanisms as it is the case for TGF-b1 stimulation [2,55] In contrast to ET-1, ...
  • 13
  • 156
  • 0

Báo cáo hóa học: " Simultaneous circulation of genotypes I and III of dengue virus 3 in Colombia" docx

Báo cáo hóa học:
... Ecuador00b I I I I I I I I I I I I I I I I I I I I I I (V)b I (V)b I (V)b II II II II II II II II II II II II II II II III III III III III III III III III III III III III III III III III III III III 1998 ... Asia/S.Pacific (I) India (III) India (III) India (III) India (III) India (III) India (III) India (III) India (III) India (III) India (III) India (III) India (III) India (III) India (III) India ... (III) India (III) India (III) India (III) India (III) India (III) India (III) India (III) India (III) India (III) *Code in Laboratorio de Virologia, INS repository (Instituto Nacional de Salud,...
  • 10
  • 86
  • 0

Financial Audit of the Department of Agriculture A Report to the Governor and the Legislature of the State of Hawai`i Report No. 05-02 April 2005_part1 docx

Financial Audit of the Department of Agriculture A Report to the Governor and the Legislature of the State of Hawai`i Report No. 05-02 April 2005_part1 docx
... The Auditor State of Hawai`i OVERVIEW Financial Audit of the Department of Agriculture Report No 05-02, April 2005 Summary The Office of the Auditor and the certified public accounting firm of ... Grant Thornton LLP conducted a financial audit of the Department of Agriculture, State of Hawai`i, for the fiscal year July 1, 2003 to June 30, 2004 The audit examined the financial records and ... is a report of the financial audit of the Department of Agriculture, State of Hawai`i, for the fiscal year July 1, 2003 to June 30, 2004 The audit was conducted pursuant to Section 23-4, Hawai`i...
  • 11
  • 62
  • 0

Xem thêm

Từ khóa: Đề cương chi tiết môn học Thực tập khí nén (Trường cao đẳng bán công công nghệ và quản trị doanh nghiệp)Đề cương chi tiết môn học Thực tập trang bị điện (Trường cao đẳng bán công công nghệ và quản trị doanh nghiệp)Bộ đề ôn tập Toán 6 học kì 2Đề cương chi tiết môn học Thí nghiệm máy điện (Trường cao đẳng bán công công nghệ và quản trị doanh nghiệp)MUC LUC CHUANĐỀ THI THỬ KÌ THI THPT QUỐC GIA LẦN 5 NĂM 2015 Môn: Vật lýChinh phục 8, 9, 10 điểm môn toán từ các đề thi thử - P2ĐỀ KHẢO SÁT CHẤT LƯỢNG LỚP 12 LẦN 1 NĂM 2014Đề cương chi tiết môn học Vi mạch tương tự (Trường cao đẳng bán công công nghệ và quản trị doanh nghiệp)Bộ đề ôn luyện mục tiêu 8 điểm môn toánde thi thu thptqg nam 2017 de so 1 co loi giaiBai 40 bai tap kim loai kiem kiem tho n3 pdfFULL 11 đề môn hóa TÙNG TNVbài du thi day hoc tich hop liên môn toán học bậc thcsđề thi thử môn hóa 2017 chất lượngThư viện đại học với vấn đề tài nguyên giáo dục mởTìm hiểu 4 nguyên tắc cơ bản 4RS trong việc mở đối với nguồn học liệu mởTối ưu hóa công cụ tìm kiếm (SEO) cho báo điện tửTriết lý nhân sinh của thiền phái Trúc Lâm Yên Tử và giá trị lịch sử của nóTruyền thông về hình ảnh đất nước, con người, văn hóa Việt cho người Việt Nam ở nước ngoài trên kênh truyền hình đối ngoại VTC10-Netviet
Nạp tiền Tải lên
Đăng ký
Đăng nhập