19900 famiily members

Asean Members

Asean Members
  • 1
  • 131
  • 2

Class Members and Class Reuse

Class Members and Class Reuse
... 30 Chapter 3: Class Members and Class Reuse and preceded by the keyword static as shown here in the class Id This class is responsible for generating a unique ... C function and must be referred to by the class name Math EBNF 32 Chapter 3: Class Members and Class Reuse 3.1.2 EBNF ■ Accessing Fields For a field to be accessed from outside the class itself, ... from various classes and places them inside another class Aggregation, therefore, reuses classes by assembling objects of existing classes to define, at least in part, the data members and methods...
  • 25
  • 133
  • 0

Tài liệu Class, Structure, and Interface Members docx

Tài liệu Class, Structure, and Interface Members docx
... constructor for the SqlCommand class is: public SqlCommand( ); In VB, the constructor is represented by a call to a class's New subprocedure The equivalent call to the SqlCommand class constructor ... Sub New( ) A.5.3 Properties The SqlCommand.CommandText property provides a typical example of a property definition using C# syntax: public string CommandText {get; set;} Like all C# type definitions, ... number of object-oriented qualifiers with methods These, and their VB equivalents, are shown in Table A-4 Table A-4 C# keywords used with methods and their VB equivalents C# keyword VB keyword abstract...
  • 5
  • 231
  • 0

Tài liệu Defining Members pptx

Tài liệu Defining Members pptx
... The members in this class, statePopulation, setPopulation(), and getPopulation(), are all publicly accessible ... property or method can be declared private or public, as you see fit Why would you want to hide some members in this way? Because a robust class definition often has many properties and methods that ... class), Flash displays an error and lets you know that you need to reexamine your code Static Members By default, every member of a class is duplicated within an instance whenever that instance...
  • 7
  • 31
  • 0

Tài liệu Báo cáo khoa học: Regulation of the members of the mammalian heat shock factor family doc

Tài liệu Báo cáo khoa học: Regulation of the members of the mammalian heat shock factor family doc
... (2001) Roles of ¨ the heat shock transcription factors in regulation of the heat shock response and beyond FASEB J 15, 1118–1131 Fujimoto M & Nakai A (2010) The heat shock factor family and adaptation ... In accordance with the fundamental role of HSF1 in the heat shock response, the requirement of HSF1 and HSF4 in development of the lens and olfactory epithelium is limited to the postnatal period, ... by the recent findings that different members of the HSF family are able to interact, both structurally and functionally, thereby impacting the actions of their partners The interplay among the...
  • 14
  • 236
  • 0

Tài liệu Báo cáo khoa học: Arabidopsis thaliana BTB⁄ POZ-MATH proteins interact with members of the ERF⁄AP2 transcription factor family ppt

Tài liệu Báo cáo khoa học: Arabidopsis thaliana BTB⁄ POZ-MATH proteins interact with members of the ERF⁄AP2 transcription factor family ppt
... to assemble with members of the ethylene response factor ⁄ Apetala2 (ERF ⁄ AP2) transcription factor family We also provide a detailed description of the Arabidopsis thaliana BPM family expression ... proteins assemble with members of the ERF ⁄ AP2 transcription factor family Because it has been shown previously that Arabidopsis BPM proteins use their BTB ⁄ POZ domain to interact with the cullins ... BPM proteins interact with members of the ERF ⁄ AP2 family (A) Y2H assays demonstrate the assembly of BPM1(1–189) and BPM3 with RAP2.4 and RAP2.13, respectively (B) Schematic drawing of the BPM1...
  • 12
  • 326
  • 0

Tài liệu Báo cáo khoa học: Structural and functional specificities of PDGF-C and PDGF-D, the novel members of the platelet-derived growth factors family docx

Tài liệu Báo cáo khoa học: Structural and functional specificities of PDGF-C and PDGF-D, the novel members of the platelet-derived growth factors family docx
... PDGF-C and -D, structure and function L J Reigstad et al endothelial growth factors (VEGF) and the family is therefore often referred to as the PDGF ⁄ VEGF family The PDGF family of growth factors ... however further understanding of how these factors interplay with other members of the cystine knot family and in particular the PDGF-A, -B, and VEGF growth factors, must be the focus of future ... PDGF-D, resulting in perivascular lymphoid cell infiltrates of the lung and fibrosis in the liver [110] Conclusions The novel members, PDGF-C and -D, of the PDGF subfamily of the cystine knot family...
  • 19
  • 206
  • 0

Tài liệu Báo cáo Y học: Divergent members of a soybean (Glycine max L.) 4-coumarate:coenzyme A ligase gene family potx

Tài liệu Báo cáo Y học: Divergent members of a soybean (Glycine max L.) 4-coumarate:coenzyme A ligase gene family potx
... 5¢-GTGAGAAATGGAGATGCTGC-3¢ 5¢-TGTTCCGGAGAGCCTCCTC-3¢ 5¢-CAACGGAAGCACGCATAGGAGCAC-3¢ 5¢-CACCGCATGCATAACTCTAGCTCCTTCTCTTG-3¢ 5¢-GTAAAACGACGGCCAGT-3¢ Ó FEBS 2002 4-Coumarate:CoA ligase gene family from ... 5¢-TBACNCARTCNGCNTAYGTBGARAA-3¢ 5¢-GTTCTAAGCTTTTAAGGCGTCTGAGTGGC-3¢ 5¢-AGTTTCAGGGTCAACAACCCTG-3¢ 5¢-CTCGAATTCATGACAACGGTAGCTGCTTCTC-3¢ 5¢-CTCGGATCCATGGCTGATGATGGAAGCAG-3¢ 5¢-TCAGCGTCACCGTTATCCTC-3¢ ... Relative Vmax (% of coumarate) Relative Vmax/Km (lM)1) Gm4CL1 Cinnamate 4-Coumarate Caffeate Ferulate Sinapate 3,4-Dimethoxycinnamate Cinnamate 4-Coumarate Caffeate Ferulate Sinapate 3,4-Dimethoxycinnamate...
  • 12
  • 181
  • 0

Báo cáo khoa học: Differential recognition of heat shock elements by members of the heat shock transcription factor family ppt

Báo cáo khoa học: Differential recognition of heat shock elements by members of the heat shock transcription factor family ppt
... Roles of the heat shock transcription factors in regulation of the heat shock response and beyond FASEB J 15, 1118–1131 Voellmy R (2004) On mechanisms that control heat shock transcription factor ... HSE-type specific recognition by human HSFs resulted in robust activation by hHSF4–VP16, without changing the magnitude of the heat shock response (cp3) The mutational analysis of the CRYGA and CRYGC ... (2007) Different mechanisms are involved in the transcriptional activation by yeast heat shock transcription factor through two different types of heat shock elements J Biol Chem 282, 10333–10340 10...
  • 13
  • 200
  • 0

Báo cáo khoa học: The Vps4 C-terminal helix is a critical determinant for assembly and ATPase activity and has elements conserved in other members of the meiotic clade of AAA ATPases pdf

Báo cáo khoa học: The Vps4 C-terminal helix is a critical determinant for assembly and ATPase activity and has elements conserved in other members of the meiotic clade of AAA ATPases pdf
... TGGACGGATATTGAAGCTGATCTCACCATAAAGGAT ATCCTTTATGGTGAGATCAGCTTCAATATCCGTCCA TTAAAGGCTATCAAATCGCAAGAACAGTTCACTAGA TCTAGTGAACTGTTCTTGCGATTTGATAGCCTTTAA GAAGCAAGAACAGTTCACTTAGTCAATTGATTAACGTG CACGTTAATCAATTGACTAAGTGAACTGTTCTTGCTTC ... be other meiotic clade AAA ATPases and have the AAA domain helix and the C-terminal helix, but not the b domain The distinguishing feature of members of the meiotic clade of AAA ATPases is the ... Role of the Vps4 C-terminal helix Fig 11 A C-terminal helix is a characteristic feature of meiotic clade AAA ATPases Sequence alignments of some of the proteins listed in the PFAM database that...
  • 23
  • 237
  • 0

Báo cáo khoa học: Relation between domain evolution, specificity, and taxonomy of the a-amylase family members containing a C-terminal starch-binding domain pot

Báo cáo khoa học: Relation between domain evolution, specificity, and taxonomy of the a-amylase family members containing a C-terminal starch-binding domain pot
... involve also the cluster of acarviose transferase (Actsp), archaeal CGTase (Thcsp) and the maltogenic a- amylase (Bacst) due to its longer branch separating it from the Ó FEBS 2003 a- Amylase family members ... branches adjacent to each other and close to the border that separates the two major parts of the tree Note that the B stearothermophilus maltogenic a- amylase (Bacst) is placed in the ÔCGTase ... based on the alignments of the individual domains A, B, C and E (i.e the SBD) A tree was not constructed on the D domain because, as mentioned above, the fourdomain amylases and the two CGTases...
  • 11
  • 238
  • 0

Xem thêm

Từ khóa: SKKN PHƯƠNG PHÁP PHỤ đạo học SINH yếu kém môn hóa học 12SKKN sử DỤNG PHIẾU học tập TRONG một số bài học hóa 10 (2)Quickstart SEO search engine optimization raymond wayne21 ly thuyet ve dao dong tat dan dao dong cuong buc giai btapSKKN khắc phục học sinh yếu kém môn hóa lớp 10SKKN KHAI THÁC điều KIỆN PHẢN ỨNG và HIỆN TƯỢNG pư HH để tạo HỨNG THÚ học CHƯƠNG OXI lưu HUỲNHSKKN một số LIÊN hệ THỰC TIỄN TRONG bài dạy hóa học 10SKKN một số vấn đề về PHÓNG xạ hạt NHÂN dùng trong việc bồi dưỡng học sinh giỏi môn hóa học THPTSKKN PHÂN DẠNG bài tập sắt và sắt OXIT GIÚP học SINH lớp 12 TRƯỜNG PTDT nội TRÚ THSC THPT bắc hà làm bài tập hóa tốt hơnSKKN PHÂN LOẠI và PHƯƠNG PHÁP GIẢI bài tập ANCOLSKKN phương pháp giải bài tập điện phân dung dịchSKKN PHƯƠNG PHÁP GIẢI bài tập NHẬN BIẾT CHẤT hữu cơ BẰNG PP hóa học DÀNH CHO HS PHỔ THÔNGSKKN SD PP TRỰC QUAN vào GIẢNG dạy PHẦN HIDROCACBON lớp 11SKKN TINH THỂSKKN ỨNG DỤNG PM MACROMEDIA FLASH 8 THIẾT kế một số mô HÌNH ĐỘNG TRONG môn hóa học lớp 10Các mẩu quảng cáo trên facebook thường dùngTăng cường sử dụng dịch vụ ngân hàng điện tử của khách hàng cá nhân tại ngân hàng thương mại cổ phần ngoại thương vietcombank chi nhánh huếHoàn thiện công tác quản lý ngân sách các trường THPT tại tỉnh quảng trịNâng cao chất lượng đội ngũ cán bộ công chức thuộc liên đoàn lao động tỉnh quảng bìnhSKKN hóa 11 sử dụng sơ đồ tư duy trong dạy học hóa 11 nâng cao
Nạp tiền Tải lên
Đăng ký
Đăng nhập