The role of the police force in society

Topic 69: Discuss the role of the police force in society

Topic 69: Discuss the role of the police force in society
... vậy, 14 interference (n) : can thiệp, xen vào 15 law-abiding : trung thành với pháp luật, tuân theo luật pháp 16 frown (v) : không lòng, phản đối 17 prove (v): tỏ ra, chứng tỏ, chứng minh 18 dedicated...
  • 2
  • 25
  • 0

Topic 63: Discuss the role of the police force in society

Topic 63: Discuss the role of the police force in society
... vậy, 14 interference (n) : can thiệp, xen vào 15 law-abiding : trung thành với pháp luật, tuân theo luật pháp 16 frown (v) : không lòng, phản đối 17 prove (v): tỏ ra, chứng tỏ, chứng minh 18 dedicated...
  • 2
  • 27
  • 0

The role of the police force in society

The role of the police force in society
... lượng cảnh sát đóng vai trò quan trọng việc trì luật pháp trật tự xã hội Nó nguồn sức mạnh tinh thần, tự tin hạnh phúc cho tất cá nhân tìm hiểu để sống sống tốt đẹp xã hội Lý tưởng lực lượng cảnh ... hoạt động lực lượng cảnh sát tham gia tăng tự tin sức mạnh đạo đức người xã hội Ngay người què không hợp lệ cho hộ Vì vậy, ngày người ta sống an ninh lớn hạnh phúc họ có trước Đó, xã hội thiếu ... viên lực lượng làm để tìm thấy đưa ông trở lại với gia đình mình, nhiên khó chịu nỗ lực chứng minh Hiếm họ từ bỏ tìm kiếm họ họ chắn người đàn ông sống sót Dành riêng cho dịch vụ xã hội, họ sẵn...
  • 3
  • 9
  • 0

Tài liệu Role of diffusion-weighted imaging in the diagnosis of gynecological diseases pdf

Tài liệu Role of diffusion-weighted imaging in the diagnosis of gynecological diseases pdf
... satisfactory in the evaluation of nodal status in this patient group Since the highly cellular tissue in reactive lymph nodes may also show increased intensity, the role of DWI and ADC in distinguishing ... parallel imaging technique (SENSE factor of 2) Imaging time of DWI was 90 s for 20 slices Detection of uterine malignancy The ADC values of uterine cancers are lower than of normal tissue On the other ... Functional MR imaging of the female pelvis J Magn Reson Imaging 25:1101–1112 25 Koyama T, Tamai K, Togashi K (2006) Current status of body MR imaging: fast MR imaging and diffusionweighted imaging Int...
  • 16
  • 280
  • 0

Tài liệu Báo cáo khoa học: Mitochondrial targeting of intact CYP2B1 and CYP2E1 and N-terminal truncated CYP1A1 proteins in Saccharomyces cerevisiae ) role of protein kinase A in the mitochondrial targeting of CYP2E1 pdf

Tài liệu Báo cáo khoa học: Mitochondrial targeting of intact CYP2B1 and CYP2E1 and N-terminal truncated CYP1A1 proteins in Saccharomyces cerevisiae ) role of protein kinase A in the mitochondrial targeting of CYP2E1 pdf
... Bhagwat SV, Biswas G, Anandatheerthavarada HK, Addya S, Pandak W & Avadhani NG (199 9) Dual targeting property of the N-terminal signal sequence of P450 1A1 Targeting of heterologous proteins to ... open N-terminal signal domain is critical for protein targeting to the ER (Fig 2D) In contrast to the targeting of CYP 1A1 requiring N-terminal truncation, we have shown that intact CYP2B1 and CYP2E1 ... that xenobiotic-inducible CYPs such as rat CYP 1A1 , CYP2E1 and CYP2B1, and mouse CYP 1A1 , contain chimeric noncanonical -targeting signals that are capable of targeting proteins to both the ER and...
  • 16
  • 178
  • 0

Tài liệu Báo cáo khoa học: Role of K22 and R120 in the covalent binding of the antibiotic fosfomycin and the substrate-induced conformational change in UDP-N-acetylglucosamine enol pyruvyl transferase docx

Tài liệu Báo cáo khoa học: Role of K22 and R120 in the covalent binding of the antibiotic fosfomycin and the substrate-induced conformational change in UDP-N-acetylglucosamine enol pyruvyl transferase docx
... chain of K22 participates in fosfomycin binding, thus providing a rationale for the loss of fosfomycin binding to the K22V and K22E mutant proteins However, two other positively charged amino ... enthalpies of binding and stoichiometries were determined from the binding isotherm by fitting a : binding model to the data using the software provided by the manufacturer Results Reaction of fosfomycin ... together, our combined calorimetric and protein chemical approach leads to a more detailed understanding of the role of K22 and R120 with respect to fosfomycin binding as well as the ligand-induced...
  • 9
  • 231
  • 0

Tài liệu Báo cáo khoa học: Models and mechanisms of O-O bond activation by cytochrome P450 A critical assessment of the potential role of multiple active intermediates in oxidative catalysis doc

Tài liệu Báo cáo khoa học: Models and mechanisms of O-O bond activation by cytochrome P450 A critical assessment of the potential role of multiple active intermediates in oxidative catalysis doc
... [106,107] A step forward in the analysis of Fe(III)-OO(H) as a potential catalyst was thought to be offered by the use of mutated P450s, bearing alanine or some other amino acid in place of the highly ... Hlavica, P (1983) Mechanisms of extrahepatic bioactivation of aromatic amines: the role of hemoglobin in the N-oxidation of 4-chloraniline In Extrahepatic Drug Metabolism and Chemical Carcinogenesis ... playing an important role in the aromatization process in concert with a histidine residue through facilitating abstraction of the 2b-hydrogen in the A- ring of the C-19 substrate and donation of...
  • 26
  • 178
  • 0

Tài liệu The Role of Public Regional Universities in Community and Economic Development doc

Tài liệu The Role of Public Regional Universities in Community and Economic Development doc
... stable supply of knowledge and skills in high need areas Increase the size, diversity of skills and productivity of the labor force Dimensions of Social and Economic Value Regional public institutions ... business Best Practice Highlights Slippery Rock University Regional Learning Alliance – workforce development and training/collaborations with business and industry; meeting the training and ... sources of innovation that can provide the impetus for economic development Applying knowledge and forming intellectual capital Nearly two-thirds of National Association of State Universities and Land-Grant...
  • 29
  • 237
  • 0

Tài liệu Báo cáo khoa học: Electrostatic role of aromatic ring stacking in the pH-sensitive modulation of a chymotrypsin-type serine protease, Achromobacter protease I pdf

Tài liệu Báo cáo khoa học: Electrostatic role of aromatic ring stacking in the pH-sensitive modulation of a chymotrypsin-type serine protease, Achromobacter protease I pdf
... 2002 Aromatic stacking in API (Eur J Biochem 269) 4153 Fig Stick models of the reactive site in bovine trypsin and API The catalytic triad residues of trypsin and API are Ser195–His57– Asp102 and ... because several serine proteases not have an aspartate as the catalytic apparatus M NaCl However, for chymotrypsin-type serine proteases, the replacement of this aspartate with an alanine diminishes ... side-chain In the protein interior, the dielectrostatic constant is lower than on the protein surface, while the dielectrostatic constant in water is about 80 and that in the protein interior is...
  • 7
  • 161
  • 0

Tài liệu Báo cáo Y học: Exploring the role of a glycine cluster in cold adaptation of an alkaline phosphatase pdf

Tài liệu Báo cáo Y học: Exploring the role of a glycine cluster in cold adaptation of an alkaline phosphatase pdf
... 5¢-d(TCAGAAATTAAAGCGG ATGCATTATTTGCATG)-3¢ The upstream primer containing the NdeI restriction site (underlined) was: 5¢-d(GCTAGCATATGAAGCTTAAA AAAATTG)-3¢ and the downstream primer containing the ... value almost 2.5-fold higher than the native cold adapted enzyme (Table 1) The mutant G26 1A /Y2 6 9A exhibits an Ea almost the same as in the case of the native enzyme (Table 1) Thermal inactivation ... dimensional model of the wild type (A) and mutant alkaline phosphatases G26 1A (B) and G26 1A /Y2 6 9A (C); only residues that where studied are shown respectively By introducing an Ala residue in the place...
  • 6
  • 138
  • 0

Báo cáo khoa học: Role of DptE and DptF in the lipidation reaction of daptomycin ppt

Báo cáo khoa học: Role of DptE and DptF in the lipidation reaction of daptomycin ppt
... proteins (ACPs) [14,15] The genes dptE and dptF are localized immediately upstream of the NRPSs of A21987C The resulting proteins DptE and DptF were predicted to be involved in the lipidation reaction ... the initiation module of daptomycin That DptE and DptF are involved in the lipidation process of daptomycin was first shown by Miao et al [1] In their work, the daptomycin gene cluster was heterologously ... studies involving the initiation module of daptomycin synthetase are required to prove whether DptE and DptF are essential for lipidation or whether there are additionally alternative pathways In...
  • 12
  • 198
  • 0

Báo cáo khoa học: The role of interface framework residues in determining antibody VH ⁄ VL interaction strength and antigen-binding affinity pptx

Báo cáo khoa học: The role of interface framework residues in determining antibody VH ⁄ VL interaction strength and antigen-binding affinity pptx
... observed in weaker binders Evaluation of the VH VL interaction strength To evaluate the VH VL interaction strength of these 36 clones, phages were used to infect a nonsuppressing strain, HB2151, ... strong VH VL binder, to describe the relationship, and also to identify key residues in determining the interdomain interaction strength Results Construction of an FR2 combinatorial library To investigate ... evaluating either Fv-antigen or VH VL interactions [12] As a target for the analysis, we focused on the two framework region (FR2) regions of VH and VL, each facing the domain interface of the anti-lysozyme...
  • 11
  • 165
  • 0

Báo cáo khoa học: "The Role of Lexico-Semantic Feedback in Open-Domain Textual Question-Answering" ppt

Báo cáo khoa học:
... Claire Cardie, Vincent Ng, David Pierce, Chris Buckley Examining the role of statistical and linguistic knowledge sources in a general-knowledge que stion answering system In Proceedings of the 6th ... periments with Open-Domain Textual Question Answering In the Proceedings of the 18th International Conference on Computational Linguistics (COLING-2000), pages 292298, 2000 Frederick Jelinek, John ... the role of lexico-semantic feedbacks Table lists the quantitative analysis of the feedback loops Loop was generated more often than any other loop However, the small overall average number of feedback...
  • 8
  • 195
  • 0


Báo cáo
... 5.2.) Hypothesis 2: When the gift recipient s perception of prior attitude toward a brand is neutral and the giver -recipient relationship is strong, then the gift recipient s post -brand attitude ... level of recipient s perception of prior brand attitudes - Hypothesis 7a: The recipient s post brand attitude change is greater when receiving the prior neutral brand than the prior favorable brand ... self-interest or obligation motives Rather, Goodwin et al (1990) suggested that there may be elements of self-interest and obligation as a joint motive of the gift- giver Gift- giving occasion Gift- giving/receiving...
  • 10
  • 175
  • 0

Xem thêm

Nạp tiền Tải lên
Đăng ký
Đăng nhập