8964 rihanna an rn b star from the carribean

Báo cáo khoa học: Increased susceptibility of b-glucosidase from the hyperthermophile Pyrococcus furiosus to thermal inactivation at higher pressures pptx

Báo cáo khoa học: Increased susceptibility of b-glucosidase from the hyperthermophile Pyrococcus furiosus to thermal inactivation at higher pressures pptx
... 10 of the experiment This inactivation was not due to a temperature rise during pressurization The b-glucosidase from P furiosus does not become inactivated after weeks of storage at temperatures ... compared to that of unpressurized samples The influence of pressure treatment on enzyme inactivation The inactivation of b-glucosidase was measured after pressure release as a function of the incubation ... aggregate [21] The thermal stability of b-glucosidase was assessed by plotting the temperature dependence of the peak intensity at 1618 cm)1 (Fig 4B) The melting point of the enzyme was estimated to...
  • 9
  • 162
  • 0

Báo cáo khoa học: Shewasin A, an active pepsin homolog from the bacterium Shewanella amazonensis pptx

Báo cáo khoa học: Shewasin A, an active pepsin homolog from the bacterium Shewanella amazonensis pptx
... Purification and analysis of recombinant shewasin A active site mutant The active site mutant shewasin A_(D37A) was expressed in E coli, purified according to the protocol optimized for shewasin A ... positive mutant clones were confirmed by DNA sequencing Expression and purification of recombinant shewasin A and the active site mutant in E coli Wild-type shewasin A and shewasin A_(D37A) were transformed ... horizontal gene transfer mechanism Another interesting feature of the bacterial pepsin homologs [9] is the difference in their Cys content and position within the sequence Shewasin A contains eight...
  • 10
  • 233
  • 1

Báo cáo khoa học: NMR studies on the interaction of sugars with the C-terminal domain of an R-type lectin from the earthworm Lumbricus terrestris pot

Báo cáo khoa học: NMR studies on the interaction of sugars with the C-terminal domain of an R-type lectin from the earthworm Lumbricus terrestris pot
... compilation ª 2009 FEBS 2101 Interaction of EW29Ch with sugars H Hemmi et al constants by NMR to analyze the interaction between the protein and lactose in a solution state As mentioned above, one of ... affect the dissociation constants By contrast, because chemical-shift changes upon the addition of sugars at subdomain c were in the fast exchange regime, Kd values describing the interaction of ... dissociation constants determined by NMR The site-specific binding constants and chemical exchange regimes of EW29Ch with sugars used in this study are given Table Upon the addition of sugars, the chemical-shift...
  • 11
  • 150
  • 0

Báo cáo khoa học: Molecular cloning and functional expression of a gene encoding an antiarrhythmia peptide derived from the scorpion toxin pptx

Báo cáo khoa học: Molecular cloning and functional expression of a gene encoding an antiarrhythmia peptide derived from the scorpion toxin pptx
... E.P., Martin-Eauclaire, M.F., Mansuelle, P & Sampieri, F (1991) An anti-insect toxin purified from the scorpion Androctonus australis Hector also acts on the alpha- and beta-sites of the mammalian ... Sampieri, F & Granier, C (1991) An anti-insect toxin purified from the scorpion Androctonus australis Hector also acts on the a- and b-sites of the mammalian sodium channel: sequence and circular dichroism ... obtained was displayed an ORF of 258 bp encoding a polypeptide of 85 amino acids and termed BmKIM The and 3¢ UTRs of BmKIM cDNA are 17 bp and 76 bp, respectively A single AATAAA polyadenylation...
  • 8
  • 157
  • 0

Tài liệu Báo cáo khoa học: Functional characterization of an orphan cupin protein from Burkholderia xenovorans reveals a mononuclear nonheme Fe2+-dependent oxygenase that cleaves b-diketones ppt

Tài liệu Báo cáo khoa học: Functional characterization of an orphan cupin protein from Burkholderia xenovorans reveals a mononuclear nonheme Fe2+-dependent oxygenase that cleaves b-diketones ppt
... metal–ligand distances (Table 2) compare very favorably with data in the protein database, from ˚ which an average distance of 2.03 A for Fe–N(His) was inferred [38], and a target distance of ... from genomic DNA of B xenovorans LB400 through a PCR with GAGCGGCATATGGA AATCAAACCGAAGGTTCGCGA and GAGCGGCATA TGGAAATCAAACCGAAGGTTCGCGA as the forward and reverse oligonucleotide primers, respectively ... enzymatic transformation revealed that Bxe _A2 876 catalyzed breakdown of the b-diketone substrate via oxidative carbon–carbon bond cleavage to yield methylglyoxal and acetate Kinetic characterization...
  • 15
  • 228
  • 0

Tài liệu Báo cáo khoa học: An alternative transcript from the death-associated protein kinase 1 locus encoding a small protein selectively mediates membrane blebbing pdf

Tài liệu Báo cáo khoa học: An alternative transcript from the death-associated protein kinase 1 locus encoding a small protein selectively mediates membrane blebbing pdf
... plays an important role in the membrane- blebbing process [19 ], DAPK -1 and s-DAPK -1 may be able to interact with ankyrin B via their ankyrin repeats and thus promote membrane blebbing Although these ... membrane- blebbing assay, we evaluated the activity of the mutant with the tail deletion (Flag-TD; s-DAPK1Dtail) and the protease-resistant substitution (FlagTM1; s-DAPK-1G296AR29 7A) As compared ... to the activated MEK ⁄ ERK signal like DAPK -1, it can mimic DAPK1 and induce membrane blebbing A function was also attributed to the unique tail of s-DAPK -1: it can regulate the localization and...
  • 11
  • 201
  • 0

Tài liệu Báo cáo khoa học: Characterization and mode of action of an exopolygalacturonase from the hyperthermophilic bacterium Thermotoga maritima doc

Tài liệu Báo cáo khoa học: Characterization and mode of action of an exopolygalacturonase from the hyperthermophilic bacterium Thermotoga maritima doc
... Molecular and biochemical characterisation of the thermo-active family pectate lyase from the hyperthermophilic bacterium Thermotoga maritima Biochem J 370, 651659 21 Kozianowski G, Canganella F, ... as the rst and only product on PGA and oligoGalpA On the basis of its mode of action, PelB should be classied as an exopolygalacturonase (EC To date, no crystal structure of an exopolygalacturonase ... Regulation of endo-acting glycosyl hydrolases in the hyperthermophilic bacterium Thermotoga maritima grown on glucan- and mannan-based polysaccharides Appl Environ Microbiol 68, 545554 24 Huber R, Langworthy...
  • 10
  • 264
  • 0

Tài liệu Báo cáo Y học: Purification, characterization, immunolocalization and structural analysis of the abundant cytoplasmic b-amylase from Calystegia sepium (hedge bindweed) rhizomes ppt

Tài liệu Báo cáo Y học: Purification, characterization, immunolocalization and structural analysis of the abundant cytoplasmic b-amylase from Calystegia sepium (hedge bindweed) rhizomes ppt
... b-amylase (Cys83, Cys96, Cys209 and Cys344) are homologous to those found in soybean b-amylase (Cys82, Cys97, Cys208 and Cys343) On the analogy of the soybean b-amylase, the active site of the ... for the b-amylase from C sepium using the X-ray coordinates of the soybean b-amylase (Fig 4) According to the Ramachandran plot of this model the f and c angles of most of the residues are in the ... Inhibition of the enzyme activity by glucose, maltose and cyclohexaamylose For the study of the enzyme inhibition by glucose, maltose and cyclohexaamylose b-amylase activity was measured using the iodine...
  • 11
  • 205
  • 0

Báo cáo khoa học: Crystal structures of the apo form of b-fructofuranosidase from Bifidobacterium longum and its complex with fructose pot

Báo cáo khoa học: Crystal structures of the apo form of b-fructofuranosidase from Bifidobacterium longum and its complex with fructose pot
... native enzyme and its complex with the product of hydrolysis – fructose The crystals of raffinose ($ 0.1 mg) were added to the crystallization drop with the apo crystals of b-fructofuranosidase ... of fructose The leaving group is carboxylate of Asp54 Dimerization The asymmetric units of the crystals of both the apo and complexed form of the enzyme consist of dimers with noncrystallographic ... fragments and fitting them to the electron density maps The crystal structure of the complex of b-fructofuranosidase with fructose was solved by molecular replacement using the crystal structure of the...
  • 17
  • 165
  • 0

Báo cáo khoa học: Global shape and pH stability of ovorubin, an oligomeric protein from the eggs of Pomacea canaliculata pot

Báo cáo khoa học: Global shape and pH stability of ovorubin, an oligomeric protein from the eggs of Pomacea canaliculata pot
... [29], and in fact have a small number of predators The pH stability of ovorubin is within the pH range of vertebrate digestive tract fluids [30,31], and the present results indicate that the protein ... different pH values Solid line: pH 6.0 Dotted line: pH 4.5 Dashed line: pH 2.0 On the basis of the above results, the CD spectra in the near-UV and far-UV region were only recorded at pH 2.0 and pH ... limiting the predator’s ability to digest and use essential nutrients from the eggs, thus rendering the ingestion of P canaliculata eggs antinutritive The ovorubin complex, despite its large size and...
  • 9
  • 137
  • 0

Báo cáo khóa học: A new UV-B absorbing mycosporine with photo protective activity from the lichenized ascomycete Collema cristatum docx

Báo cáo khóa học: A new UV-B absorbing mycosporine with photo protective activity from the lichenized ascomycete Collema cristatum docx
... having a great potential to protect from UV-B radiation Collemin A is a new mycosporine, which Fig Comparative UV spectra of the fungus (mycobiont) and lichen Collema cristatum The mycobiont has a ... mammals because photosynthetic organisms depend on solar irradiation as their primary source of energy, and at the same time must provide a mechanism that can counteract the damaging effects of UV-B ... by an amino acid or an amino-alcohol [11] In contrast, MAAs are UV absorbing metabolites of algae that contain an aminocyclohexenimine ring system, with UV absorption maxima between 310 and 360...
  • 5
  • 173
  • 0

Báo cáo Y học: Structural and biochemical characterization of calhepatin, an S100-like calcium-binding protein from the liver of lungfish (Lepidosiren paradoxa) docx

Báo cáo Y học: Structural and biochemical characterization of calhepatin, an S100-like calcium-binding protein from the liver of lungfish (Lepidosiren paradoxa) docx
... analysis The 105 000 g supernatant of lungfish liver (lane 1), skeletal muscle (lane 2), intestine (lane 3), lung (lane 4), brain (lane 5), adipose tissue (lane 6), heart (lane 7) and skin (lane ... showed that the protein is in a monomer–dimer equilibrium and that the dissociation constant is in the micromolar range for the apoprotein and in the submicromolar range for the holoprotein, as ... structures of other members of the family The molecule is depicted in strand representation, and a helices are numbered from I to IV (B) Residues Leu7, Arg8 and Phe11 from a-helix I, and Trp60,...
  • 9
  • 147
  • 0

Báo cáo Y học: Ferritin from the spleen of the Antarctic teleost Trematomus bernacchii is an M-type homopolymer doc

Báo cáo Y học: Ferritin from the spleen of the Antarctic teleost Trematomus bernacchii is an M-type homopolymer doc
... Ferritin from the spleen of another Antarctic teleost, G acuticeps, likewise is a homopolymer that is rich in iron [12] It appears therefore that Antarctic fish ferritins not require heteropolymeric ... compare the stability of T bernacchii ferritin with that of L-type and H-type mammalian ferritins, which are known to dissociate at pH 2.5 and 2.8–3.0, respectively [20] The stability of T bernacchii ... properties of this protein Ferritin extracted from the spleen of the Antarctic teleost Trematomus bernacchii, which lives at a constant temperature of )1.9 °C, was chosen To our knowledge only spleen ferritin...
  • 7
  • 160
  • 0

Xem thêm

Từ khóa: Vật lí đại cương lương duyên bìnhUsing excel for business analysisBusiness analysis techniques 72 essential tools for success22 đề THI THỬ vật lí GIẢI CHI TIẾT, CLB vật lýĐánh giá hiệu quả hoạt động của các chi nhánh ngân hàng thương mại trên địa bàn tỉnh vĩnh phúcNHỮNG mấu TRUYỆN NGẮN ý nghĩa của NEU confessions (1)Handbook of logistics and distribution management 2010CHỦ TRƯƠNG của ÐẢNG về xây DỰNG hợp tác xã NÔNG NGHIỆP từ năm 1958 đến năm 1965 (QUA NGHIÊN cứu TRƯỜNG hợp TỈNH hà ÐÔNG)BÁO cáo THỰC tập một số DOANH NGHIỆP vận tải THUỶ bộNGHIÊN cứu điều KIỆN tự NHIÊN và tài NGUYÊN THIÊN NHIÊN PHỤC vụ PHÁT TRIỂN bền VỮNG HUYỆN đảo KIÊN hải, TỈNH KIÊN GIANGNGHIÊN cứu, PHÁT TRIỂN ĂNG TEN VI dải KÍCH THƯỚC NHỎ BĂNG THÔNG SIÊU RỘNGKinh nghiệm khi thi sát hạch học lái xe ô tô đỗ 100%Kỹ năng tự bảo vệ khi tham gia các mạng xã hội của sinh viên trường cao đẳng sư phạm thái bìnhPHÁT TRIỂN LÀNG NGHỀ mộc ở HUYỆN ĐAN PHƯỢNG, THÀNH PHỐ hà nộiGiải pháp nâng cao hiệu quả thanh toán LC tại MSB sở giao dịchMột số thông tin về thuốc chứa GlycyrrhizinĐấy mạnh tiêu thụ sản phẩm tạịcông ty TNHH sản xuất thương mại và dịch vụ anh nguyênTăng cường thu hút FDI vào ngành thông tin truyền thông của Việt NamVận động và sử dụng ODA của WB cho thành phố Hồ Chí MinhCÔNG CUỘC xóa đói GIẢM NGHÈO ở HUYỆN THUẬN CHÂU(TỈNH sơn LA) GIAI đoạn 2006 2012
Nạp tiền Tải lên
Đăng ký
Đăng nhập