Tài liệu Báo cáo khoa học: The role of the ESSS protein in the assembly of a functional and stable mammalian mitochondrial complex I (NADH-ubiquinone oxidoreductase) pptx

Tài liệu Báo cáo khoa học: The role of the ESSS protein in the assembly of a functional and stable mammalian mitochondrial complex I (NADH-ubiquinone oxidoreductase) pptx
... number of differences in the N-terminal domain (located on the matrix side) It is likely that the N-terminal domain is involved in protein protein interactions with other hydrophilic domains of neighboring ... chain was established with succinate and glycerol3-phosphate as substrates Complex II activity was determined after addition of succinate, followed by inhibition by malonate, and complex III activity ... Inspection of the amino acid sequences of the known mammalian ESSS proteins reveals a high degree of conservation in the C-terminal domain (including the transmembrane region), but a significant...
  • 9
  • 245
  • 0

Báo cáo khoa học: Factors involved in the assembly of a functional molybdopyranopterin center in recombinant Comamonas acidovorans xanthine dehydrogenase pot

Báo cáo khoa học: Factors involved in the assembly of a functional molybdopyranopterin center in recombinant Comamonas acidovorans xanthine dehydrogenase pot
... contains 535 amino acids with a calculated average molecular mass of 57 752 Da and the a- subunit contains 808 amino acids with a calculated average molecular mass of 87 392 Da The total calculated ... (ggcaggaattgaatgcag) or the known 3¢ end of the xdhB gene (gcccagtacctacaagattc) Localization of xdhAB genes on the C acidovorans plasmid was established using the AlkPhos Fig Location of the ... and characterization of xanthine dehydrogenase in a baculovirus-insect cell system In Flavins and Flavoproteins 1993 Proceedings of the 11th International Symposium on Flavins and Flavoproteins...
  • 11
  • 200
  • 0

Báo cáo hóa học: " A fixed-point approach to the stability of a functional equation on quadratic forms" doc

Báo cáo hóa học:
... doi:10.1016/ Bae, J-H, Park, W-G: On a cubic equation and a Jensen -quadratic equation Abstr Appl Anal 2007 (2007) Article ID 45179 Găvruta, P: A generalization of the Hyers-Ulam-Rassias stability ... : = ax2 + bxy + cy2 is a solution of the Equation 1.1 The authors [12] acquired the general solution and proved the stability of the functional Equation 1.1 for the case that X and Y are real ... linear functional equation Proc Natl Acad Sci USA 27, 222–224 (1941) doi:10.1073/ pnas.27.4.222 Bae, J-H, Park, W-G: On stability of a functional equation with n variables Nonlinear Anal TMA 64, 856–868...
  • 7
  • 185
  • 0

Báo cáo hóa học: "Research Article A Fixed Point Approach to the Stability of a Functional Equation of the Spiral of Theodorus" pptx

Báo cáo hóa học:
... Hyers-Ulam-Rassias Stability of Functional Equations in Mathematical Analysis, Hadronic Press, Palm Harbor, Fla, USA, 2001 G L Forti, “Hyers-Ulam stability of functional equations in several variables,” ... Rassias, “On the stability of functional equations and a problem of Ulam,” Acta Applicandae Mathematicae, vol 62, no 1, pp 23–130, 2000 12 S.-M Jung and P K Sahoo, Stability of a functional equation ... transformations,” Bulletin of the American Mathematical Society, vol 57, pp 223–237, 1951 Th M Rassias, “On the stability of the linear mapping in Banach spaces,” Proceedings of the American Mathematical...
  • 7
  • 100
  • 0

Báo cáo khóa học: Structural characterization of the human Nogo-A functional domains Solution structure of Nogo-40, a Nogo-66 receptor antagonist enhancing injured spinal cord regeneration ppt

Báo cáo khóa học: Structural characterization of the human Nogo-A functional domains Solution structure of Nogo-40, a Nogo-66 receptor antagonist enhancing injured spinal cord regeneration ppt
... characterization of the Nogo -A functional domains (Eur J Biochem 271) 3513 Fig Schematic representation of the domain organization of the human Nogo -A protein (A) The domain organization of human ... fragments The Nogo -A cDNA (designated KIAA 0886) was obtained from the Kazusa DNA Research Institute (KazusaKamatari, Kisarazu, Chiba, Japan) A DNA fragment encoding a 182 residue Nogo -A fragment ... (designated as Nogo -A( 567–748); Fig 1) was generated by PCR with a pair of primers: 5¢-CG CGCGCGCGGATCCACTGGTACAAAGATTGCT-3¢ (forward) and 5¢-CGCGCGCGCCTCGAGCTAAAAT AAGTCAACTGGTTC-3¢ (reverse) A DNA...
  • 11
  • 183
  • 0

Chapter 2Communicating Over the Network the structure of a network, including the devices and media that are necessary for successful communications. Explain the function of protocols in network communications. Ex potx

Chapter 2Communicating Over the Network the structure of a network, including the devices and media that are necessary for successful communications. Explain the function of protocols in network communications. Ex potx
... Overview Describe the structure of a network, including the devices and media that are necessary for successful communications Explain the function of protocols in network communications Explain ... be installed – The amount of data and the speed at which it must be transmitted – The cost of the media and installation 17 Local Area Network (LAN) Local Area Network (LAN) An individual network ... running on the intermediary network devices perform these functions: – Regenerate and retransmit data signals – Maintain information about what pathways exist through the network and internetwork...
  • 52
  • 224
  • 0

Báo cáo hóa học: " Testing the potential of a virtual reality neurorehabilitation system during performance of observation, imagery and imitation of motor actions recorded by wireless functional nearinfrared spectroscopy (fNIRS)" potx

Báo cáo hóa học:
... this article as: Holper et al.: Testing the potential of a virtual reality neurorehabilitation system during performance of observation, imagery and imitation of motor actions recorded by wireless ... execution (as in traditional motor learning), imitation, observation (as in observational learning) and motor imagery Activation of these brain areas following observation or motor imagery may thereby ... within the same secondary motor areas during observation, motor imagery and overt motor execution (unilateral and bilateral group, Figure and 6) Although not all of the observed changes reached statistical...
  • 13
  • 255
  • 0

Báo cáo hóa học: "Occupational medical prophylaxis for the musculoskeletal system: A function-oriented system for physical examination of the locomotor system in occupational medicine (fokus(C))" potx

Báo cáo hóa học:
... practical experience and the limited time allowed for occupational medical examinations speak for a systematic subdivision of the physical examination into a screening phase and, based on the ... X-ray Additional material Additional file Examination Schedule 1: fokus(C) examination of the spinal column The table shows the different stages of examination of the spinal column (screening ... evidence of the stability of the syndesmosis may be obtained • The final test for stability of the calcaneofibular ligament is carried out by percussion of the examiner's fist against the heel of the...
  • 10
  • 217
  • 0

Báo cáo hóa học: " A fixed point approach to the Hyers-Ulam stability of a functional equation in various normed spaces" pptx

Báo cáo hóa học:
... using the fixed point alternative approach, we prove the Hyers-Ulam stability of the functional equation (1) in fuzzy normed spaces In the rest of the article, assume that X is a vector space and ... Non-Archimedean stability of the functional equation (1) In this section, using the fixed point alternative approach, we prove the Hyers-Ulam stability of the functional equation (1) in non-Archimedean ... stability of the functional equation (1) In this section, using the fixed point alternative approach, we prove the Hyers-Ulam stability of the functional equation (1) in random normed spaces Theorem...
  • 14
  • 200
  • 0

Báo cáo hoa học: " On the stability of a mixed type functional equation in generalized functions" ppt

Báo cáo hoa học:
... Stability of Functional Equations in Nonlinear Analysis Springer Optimization and Its Applications Springer, New York (2011) [7] Kannappan, Pl: Functional Equations and Inequalities with Applications ... D: The stability of Cauchy equations in the space of Schwartz distributions J Math Anal Appl 295, 107–114 (2004) [18] Lee, Y-S: Stability of a quadratic functional equation in the spaces of generalized ... i=1 as the equation for the spaces of generalized functions Using the fundamental solution of the heat equation, we solve the general solution and prove the Hyers– Ulam stability of this equation...
  • 21
  • 97
  • 0

Báo cáo hóa học: " Research Article Stability of a Quadratic Functional Equation in the Spaces of Generalized Functions" docx

Báo cáo hóa học:
... domains, and applied the result to the study of an interesting asymptotic behavior of the quadratic functions As a matter of fact, we reformulate 1.1 and related inequality in the spaces of generalized ... 2 Journal of Inequalities and Applications in the spaces of generalized functions Also, we obtain the general solution and prove the Hyers-Ulam stability of 1.1 in the spaces of generalized functions ... Hyers-Ulam stability of the functional equations that have the quadratic property,” Journal of Mathematical Analysis and Applications, vol 222, no 1, pp 126–137, 1998 17 L Hormander, The Analysis of...
  • 12
  • 160
  • 0

Báo cáo hóa học: " Research Article On Stability of a Functional Equation Connected with the Reynolds Opera" docx

Báo cáo hóa học:
... Isac, and Th M Rassias, Stability of Functional Equations in Several Variables, vol 34 of Progress in Nonlinear Differential Equations and Their Applications, Birkh¨ user Boston, a Boston, Mass, ... Boston, Mass, USA, 1998 [2] J Acz´ l and J Dhombres, Functional Equations in Several Variables, vol 31 of Encyclopedia of e Mathematics and Its Applications, Cambridge University Press, Cambridge, ... Journal of Inequalities and Applications Banach algebra Ꮽ They have shown that if a mapping f : X → Ꮽ satisfies f (x ◦ y) − f (x) f (y) ≤ (3) with some > 0, then there exist a commutative C ∗ -algebra...
  • 3
  • 75
  • 0

Báo cáo sinh học: "Functions of O-fucosyltransferase in Notch trafficking and signaling: towards the end of a controversy" pptx

Báo cáo sinh học:
... repeats (ANK), a transactivation domain (TAD) and a PEST domain (P) TM, transmembrane domain (b,c) Two models for the roles of Ofut1 in Notch trafficking Each model is illustrated in a schematic ... (green) adapted from [19] The S2 cleavage site is indicated by an arrow The intracellular domain (NICD) contains various elements involved in transcriptional activation: a RAM domain, seven ankyrin ... Figure 1c) in which Ofut1 regulates the endocytic trafficking of Notch at a post-internalization step so that Notch accumulates in an undefined endocytic compartment in the absence of ofut1 activity...
  • 5
  • 180
  • 0

Báo cáo y học: " Presence of a functional but dispensable Nuclear Export Signal in the HTLV-2 Tax protein" pdf

Báo cáo y học:
... factor (ATF) binding (CREB/ATF) pathway, while in the cytoplasm the viral transactivators interact with several members of the NF-κB transduction pathway [5,37] Tax1 /Tax2 activation of CREB/ATF ... Results HTLV-2 Tax protein sequence contains a putative NES domain We lately demonstrated that the HTLV-2 Tax protein has an intracellular localization that is different from that of Tax1 , both in infected ... GFP -Tax2 L18 8Y, GFP -Tax2 L18 8Y, L19 1A, GFP -Tax2 L18 8Y, LL194–195AA, GFP -Tax2 L20 0A, had a predominant cytoplasmic localization and behaved mostly like Tax2 wild-type, i.e with a strong cytoplasmic...
  • 11
  • 89
  • 0

Báo cáo y học: "Survivors of war in the Northern Kosovo (II): baseline clinical and functional assessment and lasting effects on the health of a vulnerable population" ppsx

Báo cáo y học:
... Survivors of war in the Northern Kosovo (II): baseline clinical and functional assessment and lasting effects on the health of a vulnerable population Conflict and Health 2010 4:16 Submit your next manuscript ... physical functioning and activity, participation in social life and environmental factors was obtained in further interviews using a questionnaire based on the WHO International Classification ... Vergara A, Agani F, Gotway CA: Mental health, social functioning, and attitudes of Kosovar Albanians following the war in Kosovo Jama 2000, 284(5):569-577 13 American Association for the Advancement...
  • 13
  • 137
  • 0

Xem thêm

Đăng ký
Đăng nhập