MicrowaveAssisted Fluorous Synthesis of a 1,4Benzodiazepine2,5dione Library

Báo cáo khoa học: Identification of calreticulin as a ligand of GABARAP by phage display screening of a peptide library pdf

Báo cáo khoa học: Identification of calreticulin as a ligand of GABARAP by phage display screening of a peptide library pdf
... appeared By comparison with the spectrum of N1-liganded GABARAP (A) , these resonance signals can be attributed to N1-liganded GABARAP By binding to GABARAP, N1 peptide displaces CRT from GABARAP A few ... A dissociation constant of 64 nm for the GABARAP CRT interaction was Calreticulin is a high affinity ligand for GABARAP Fig Homology model of CRT(1–332) with an illustration of liganded GABARAP ... folded GABARAP [22] The addition of CRT to GABARAP resulted in the disappearance of GABARAP resonances, a clear indication of binding (Fig 3B) Only weak amide signals for a Gln ⁄ Asn side chain and...
  • 13
  • 260
  • 0

Báo cáo khoa học: Efficient synthesis of a disulfide-containing protein through a batch cell-free system from wheat germ pdf

Báo cáo khoa học: Efficient synthesis of a disulfide-containing protein through a batch cell-free system from wheat germ pdf
... 5¢-CAAAAAATTGAATGGCATG AACCGCCGAGCTCCAAC-3¢ and a2 : 5¢-AGCTTCAA AAATATCATTTAAACCCGACGGGCTGCTTTT-3¢ (the sequences for the biotin tag are underlined) followed by circularization with DNA ligase ... The DNA fragment coding the scFvLH (10 pg) was amplified with 0.4 lM each of the primers s1: 5¢-CTACC AGATCTGCCATGCAGATCGTTGTTACCCAGG-3¢ and a1 : 5¢-GGCTAAGAGCTCACGGTCAGGCTCG-3¢ by using a LATaq PCR ... E coli cell-free system with chaperones was nearly half of the synthesized protein, which was almost the same as in our case Therefore, the wheatgerm system might have a practical advantage over...
  • 7
  • 141
  • 0

facile hydrothermal route to the controlled synthesis of a - fe2o3 1 - d nanostructures

facile hydrothermal route to the controlled synthesis of a - fe2o3 1 - d nanostructures
... occurred immediately Then the mixture solution was transferred into a commercial stainless steel Tef- lon-lined autoclave of 50 mL capacity The autoclave was maintained at a temperature of 18 0°C ... water and absolute ethanol respectively, and finally dried in air at 60°C The XRD pattern of prepared powder sample was collected using a Rigaku D/ Max-2200PC X-ray diffractometer using CuKα radiation ... = 1 5 417 8 Å) and a graphite monochromator Transmission electron microscopy (TEM) Facile hydrothermal route to the controlled synthesis of α -Fe2O3 1- D nanostructures Figure (a, e) TEM images of...
  • 5
  • 217
  • 0

simple and rapid synthesis of a-fe2o3 nanowires under ambient conditions

simple and rapid synthesis of a-fe2o3 nanowires under ambient conditions
... Srivastava, A K; Nandedkar, R V Growth and characterization of alpha-Fe2O3 nanowires J Appl Phys 2007, 102, 054303 [14] Dong, W T.; Zhu, C S Use of ethylene oxide in the sol gel synthesis of alpha-Fe2O3 ... Material (ESM) In spite of intensive research into one-dimensional structures of metal oxides in particular and NWs in general, our understanding of the mechanisms of their formation and growth is still ... accumulated in the Fe3O4 and FeO layers and cannot directly affect the 377 Nano Res (2009) 2: 373 379 growth of the NWs Figure shows our understanding of the NW formation conditions and a suggested mechanism...
  • 7
  • 259
  • 0

Báo cáo hóa học: " A truly green synthesis of a-aminonitriles via Strecker reaction" pdf

Báo cáo hóa học:
... enantioselective Strecker reactions and analogous syntheses Chem Rev 103:2795–2827 doi:10.1021/cr020038p Arasappan A, Venkatraman S, Padilla AI, Wu W, Meng T, Jin Y, Wong J, Prongay A, Girijavallabhan V, ... GKS, Mathew T, Panja C, Alconcel S, Vaghoo H, Do C, Olah GA (2007) Gallium (III) triflate catalyzed efficient Strecker reaction of ketones and their fluorinated analogs Proc Nat Acad Sci USA 104:3703–3706 ... G, Zhao G, Wang J (2009) Strecker- type reaction catalyzed by carboxylic acids in aqueous media Synthesis 12:2035–2039 29 Ishitani H, Komiyama S, Hasegawa Y, Kobayashi S (2000) Catalytic asymmetric...
  • 5
  • 97
  • 0

Báo cáo hóa học: " Research Article Stability Analysis and Intermittent Control Synthesis of a Class of Uncertain Nonlinear Systems" doc

Báo cáo hóa học:
... intermittent control, and some exponential stability criteria are established Finally, some conclusions and remarks are drawn in Section Problem Formulation and Preliminaries Consider a class of nonlinear ... ≥ to denote a positive negative, seminegative, and semipositive definite matrix P Journal of Inequalities and Applications Exponential Stabilization of a Class of Uncertain Nonlinear System This ... paper, we deal with the exponential stabilization problem of a class of uncertain nonlinear systems by means of periodically intermittent control Based on Lyapunov function approach, several stability...
  • 13
  • 259
  • 0

Báo cáo sinh học: "Construction and characterization of a BAC library from a gynogenetic channel catfish Ictalurus punctatus" pps

Báo cáo sinh học:
... culture was aliquoted and stored at −80 ◦ C for subsequent screening by hybridization 2.2 Characterization of the BAC library BAC DNA was isolated from 100 colonies randomly chosen from each fraction ... and µL was used to inoculate a new overnight culture This was repeated on day 2, 3, 4, and until 100 generations had passed BAC DNA from each clone was prepared as above on day and NotI and HindIII ... gridded cattle BAC library, Anim Genet 31 (2000) 347–351 [3] Cai L., Taylor J.F., Wing R .A. , Gallagher D.S., Woo S.-S., Davis S.K., Construction and characterization of a bovine bacterial artificial...
  • 11
  • 54
  • 0

Toward synthesis of a macrocyclic hybrid aromatic pentamer

Toward synthesis of a macrocyclic hybrid aromatic pentamer
... TOWARD SYNTHESIS OF A MACROCYCLIC HYBRID AROMATIC PENTAMER SUN XIAONAN (M.Sc.) PKU A THESIS SUBMITTED FOR THE DEGREE OF MASTER OF SCIENCE DEPARTMENT OF CHEMISTRY NATIONAL UNIVERSITY OF SINGAPORE ... synthetic facility, high structural diversity and adaptability In this regard, the aim of this study was to design and synthesize a new class of cyclic pentamer with tunable cation-binding cavities and ... macrocycles (b) Macrocycles assembling anistropically into a tubular structure that acts as a transmembrane channel or pore in the hydrophobic environment of a lipd bilayer     A set of structurally well-defined...
  • 38
  • 23
  • 0

SolidPhase Synthesis of Tetrahydro1,4 benzodiazepine2one Derivatives as a βTurn Peptidomimetic Library

SolidPhase Synthesis of Tetrahydro1,4 benzodiazepine2one Derivatives as a βTurn Peptidomimetic Library
... to build a useful peptidomimetic library Benzodiazepine classes have been an important class of compounds that have displayed selective activities against a diverse array of biological targets,10,11 ... Solid-Phase Synthesis of Tetrahydro-1,4-benzodiazepine-2-one Derivatives as a β-Turn Peptidomimetic Library Isak Im,† Thomas R Webb,‡ Young-Dae Gong,§ Jae-Il Kim,† and Yong-Chul Kim*,† Department of ... 7-alkoxy-4-arylalkyl-1,3,4,5-tetrahydro-benzo[e][1,4]diazepin-2-one library O-alkylation at the C-7 position was carried out with alkylhalides and 1,8-diazabicycl[5.4.0]undec7-ene (DBU) as a...
  • 8
  • 249
  • 0

Tài liệu Báo cáo " synthesis, cloning and expression in escherichia coli of a gene coding for Mcoti-ii " ppt

Tài liệu Báo cáo
... gtgactgcag gaaggggatc cggctgctaa caaagcccga 280 281 aaggaagctg agttggctgc tgccaccgct gagcaataac 320 321 tagcataccc 361 TTTTTGCTGA cttggggcct AAGGAGGAAC ctaaacgggt TATATCCGGA cttgaggggt TATCCCGCAA ... taagacttttttacggcggcgctatcgctaacgggcccgcgc attctgaaaaaatgccgccgcgatagcgattgcccgggcgcg I L K K C R R D S D C P G A acgtaaacggcgccgttgccgataacgccgattgagctcggc tgcatttgccgcggcaacggctattgcggctaactcgagccg ... TATCCCGCAA 360 400 401 GAGCCCGGCA GTACCGGCAT AACCAAGCCT ATGCCTACAG 440 441 CATCCAGGGT TTG GACGGTGCCG AGGATGACGA TGAAGCGCCA 480 Fig Sequence of recombinant plasmid DNA containing TI gene fragment Expression...
  • 9
  • 243
  • 0

Tài liệu Management Information Systems A Synthesis of Transit Practice ppt

Tài liệu Management Information Systems A Synthesis of Transit Practice ppt
... Authority Atlanta, Georgia Metro-Dade Transit Agency Miami, Florida San Francisco Bay Area Rapid Transit District Oakland, California Metra (Metropolitan Rail) Chicago, Illinois MTA New York City Transit ... sophisticated applications in at least one of the four management and operational areas under consideration (i.e., administration, planning and operations, materials management, and advanced technology ... Transportation Research Board TRANSIT COOPERATIVE RESEARCH PROGRAM Synthesis of Transit Practice Management Information Systems ROGER BOLDT Consultant Kalona, Iowa Topic Panel RONALD E BOENAU,...
  • 86
  • 367
  • 0

Tài liệu Báo cáo khoa học: Physico-chemical characterization and synthesis of neuronally active a-conotoxins docx

Tài liệu Báo cáo khoa học: Physico-chemical characterization and synthesis of neuronally active a-conotoxins docx
... characterization of native a-conotoxins Analysis of neuronally active a-conotoxins using HPLC and MS, including identification of post-translational modifications Isolation and identification Standard procedures ... 2004 Characterization and synthesis of a-conotoxins (Eur J Biochem 271) 2299 Fig LC/MS analysis of crude venom from C geographus Example of experiment approach using LC/ES MS of crude extract of ... Synthetic strategies for the preparation of a-conotoxins vary between laboratories and often reflect different scientific Ó FEBS 2004 Characterization and synthesis of a-conotoxins (Eur J Biochem 271)...
  • 11
  • 218
  • 0

Tài liệu Báo cáo khoa học: Specific targeting of a DNA-alkylating reagent to mitochondria Synthesis and characterization of [4-((11aS)-7-methoxy-1,2,3,11a-tetrahydro-5H-pyrrolo[2,1-c][1,4]benzodiazepin-5-on-8-oxy)butyl]-triphenylphosphonium iodide doc

Tài liệu Báo cáo khoa học: Specific targeting of a DNA-alkylating reagent to mitochondria Synthesis and characterization of [4-((11aS)-7-methoxy-1,2,3,11a-tetrahydro-5H-pyrrolo[2,1-c][1,4]benzodiazepin-5-on-8-oxy)butyl]-triphenylphosphonium iodide doc
... alkylation leading to a depletion of mtDNA in intact cells (Fig 1) Here we report the synthesis and characterization of a novel mitochondria- targeted alkylating reagent and show that it alkylates ... One approach to increase the duration of PNA binding to DNA is to conjugate it to a DNAalkylating reagent so that the PNA becomes covalently bound to its target sequence To this a DNA alkylating ... molecular mass markers be further accumulated within the mitochondria due to the mitochondrial membrane potential [11] From the known plasma and mitochondrial membrane potentials and the cell and mitochondrial...
  • 10
  • 246
  • 0

Tài liệu Báo cáo Y học: Dinucleoside polyphosphates stimulate the primer independent synthesis of poly(A) catalyzed by yeast poly(A) polymerase ppt

Tài liệu Báo cáo Y học: Dinucleoside polyphosphates stimulate the primer independent synthesis of poly(A) catalyzed by yeast poly(A) polymerase ppt
... confirming the adenylylation of these compounds and the absence of synthesis of poly(A) by the E coli poly(A) polymerase, we did not observed adenylylation of guanosine, GDP or Gp4G by the yeast enzyme ... independent synthesis of poly(A) In order to understand why dinucleoside polyphosphates activated the primer independent synthesis of poly(A), the effect of 0.01 mM Gp4G or Ap4A on the synthesis of poly(A) ... Effect of diadenosine polyphosphates on poly(A) polymerase Previous experiments had shown that diadenosine polyphosphates also stimulated the synthesis of poly(A) catalyzed by yeast poly(A) polymerase...
  • 7
  • 223
  • 0

Xem thêm

Từ khóa: the synthesis of the modified tetrapyrrole known asd1haem requires several dedicated proteins which are coded for by a set of genes that are often found adjacent to the structural genethe code offers a synthesis of the requirementsa synthesis of hydrocarbonsirreversible addition reactions a general synthesis of alcoholsunderstanding self disclosure in chronic illness from a meta synthesis of qualitative research5 a synthesis of data and methods across scales to connect local policy decisions to regional environmental conditions the case of the cascadia scorecardcation of a clone from a gene librarya review of synthesis of 4 4 dialkylbiphenyla review of synthesis of 4 4 apos dialkylbiphenyla general synthesis of macrocyclic ruthenium ii metal complexesan evaluation of the evidence for linkages between mangroves and fisheries a synthesis of the literature and identification of research directionsfire and grazing — a synthesis of human impacts on highland biodiversitymediterranean coralligenous assemblages a synthesis of present knowledgesecrets of a super hackerthe bedrock of a culturethiết kế cafe halloweenthiết kế cafe hồn kẻ chợthiết kế cafe mộcthiết kế cafe tái chếthiết kế casio bar cafethiết kế fly flowers entertaimentthiết kế metal bar clubThiết kế nội thất khách sạn champaThiết kế nội thất resort casablanca (thuyền và biển)Thiết kế nội thất tàu lửa tàu lửa hunterTriển lãm alienwareXưởng phim hoạt hìnhKiến trúc máy tínhCÁC yếu tố ẢNH HƯỞNG đến QUYẾT ĐỊNH MUA NHÀ CHUNG cư tại TP HCMNội thất văn phòng đại diện game e aNhà hàng chay phật giáothiết kế biệt thự hương sồithiết kế café bar san hôluận văn cafe lập thểluận văn dịch vụ giải trí ori musik
Đăng ký
Đăng nhập