The use of a frailty index to predict adverse health outcomes (falls, fractures, hospitalization, medication use, comorbid conditions) in people with intellectual disabilities

Báo cáo y học: " Act In case of Depression: The evaluation of a care program to improve the detection and treatment of depression in nursing homes. Study Protocol" pptx

Báo cáo y học:
... program Act In case of Depression (AID), a multidisciplinary care program to identify and treat depression and monitor treatment effects The care program is based on and in accordance with the ... Gerritsen et al.: Act In case of Depression: The evaluation of a care program to improve the detection and treatment of depression in nursing homes Study Protocol BMC Psychiatry 2011 11:91 Submit your ... of the psychosocial, psychological and pharmacological treatment, and to determine facilitators and obstacles Secondary outcomes (percentage accuracy of depressiondetection in usual care, prevalence...
  • 7
  • 200
  • 0

Báo cáo y học: "A pilot study of a new test to predict extubation failure" pps

Báo cáo y học:
... time The patients that were unable to tolerate the additional dead space had an extubation failure rate of 75% These patients had been mechanically ventilated for a mean of 16 days and had higher ... extubated The anatomic dead space comprised in the upper airways and the intrathoracic airways is approximately ml/kg, that is about 150 ml in a normal adult [22] A study in cadavers found a mean ... patients that were unable to tolerate the additional dead space had an extubation failure rate of 75% • As this is a pilot study, the choice of the additional dead-space burden was tentative, although...
  • 9
  • 90
  • 0

Báo cáo khoa học: "The humus of a "Parabraunerde" (Orthic Luvisol) under Fagus sylvatica L and Quercus robur L and its modification in 25 years" docx

Báo cáo khoa học:
... MATERIALS AND METHODS A loamy Orthic Luvisol (Typische Parabrau- nerde, Typic Hapludalf, Sol brun lessivé) formed in the Weichselian boulder marl over fluvioglacial sands was investigated It is located ... earth worm faeces contain ≈ 50% mineral particles 30% leaf and pod Ah1 (2-5) Sandy loam, little litter and many animal faeces (0.26 g/cm The worm faeces (giv) ing a crumb structure) contain ... remains ); of the litter are less humified, and there tunnels containing Oh and Of material; Enchytraeidae faeces are dominant, as are cavities containing worm faeces Ah2 (2.5-11) Strong loamy...
  • 12
  • 90
  • 0

Báo cáo y học: " Reproducibility of the airway response to an exercise protocol standardized for intensity, duration, and inspired air conditions, in subjects with symptoms suggestive of asthma" pdf

Báo cáo y học:
... likely to be referred for exercise testing for EIB Exercise testing to identify EIB in the laboratory is affected by the type of exercise, intensity and duration of exercise, inspired air conditions, ... appreciated the opportunity afforded by design of the protocol standardized for the intensity and duration of exercise, and the condition of inspired air This allowed, for the first time, a detailed analysis ... study examined duplicate controlled exercise challenges in 373 subjects and the data provided an opportunity to examine reproducibility of the airway response to exercise in the type of individual...
  • 12
  • 80
  • 0

Tài liệu The Book Of Personal Transformation - How To Use Ancient Wisdom To Create A New Life For Yourself docx

Tài liệu The Book Of Personal Transformation - How To Use Ancient Wisdom To Create A New Life For Yourself docx
... Personal TRANSFORMATION How to Use Ancient Wisdom to Create a New Life of Success and Happiness For Yourself Dr Tim Ong M.B.B.S Personal TRANSFORMATION How to Use Ancient Wisdom to Create A New ... manifest what they visualised in their lives AFFIRMATIONS Jeff Staniforth, the creator of Sculptor 3, an amazing software that can make affirmations work for anyone, has this to say about affirmations: ... no one can stop the changes in life However, we can always choose to change for the better We can always change for personal and spiritual growth Here are a few areas we can change: Our attitude...
  • 59
  • 339
  • 2

báo cáo hóa học:" The use of average Pavlov ratio to predict the risk of post operative upper limb palsy after posterior cervical decompression" pot

báo cáo hóa học:
... concluded that Average Pavlov ratio might be a useful predictor to cervical myelopathy [17] However, the association of narrow spinal canal with the risk of post operative upper limb palsy has not ... myeloradiculopathy, the distribution of Average Pavlov ratio is expected to be skewed instead of normal, which justified the transformation of the Average Pavlov ratio into a categorical variable We used the ... Results Post operative upper limb palsy Eighteen patients (24.3%) developed post operative upper limb palsy between and days after surgery (mean 2.6 days) There was no report on the deterioration of...
  • 9
  • 172
  • 0

A Companion to the History of Economic Thought - Index pdf

A Companion to the History of Economic Thought - Index pdf
... Alternative Economic Strategy 193 American Association for the Advancement of Science 240 American Association of Labor Legislation 371 American Civil War 141, 235–6, 237 American Council of Learned ... analysis of economic interactions 16–21 analytic structure (classical approach to value/distribution) 180–1 ancien régime 54, 75, 627 ancient economics 11–24 Annales school 495 Annals of Mathematics ... policy challenge after wars 613–18 post-Ricardian economics 130–44 pre-classical economics 78–92 Reformation 636–8 see also England; Ireland British Academy 596 British Association for the Advancement...
  • 44
  • 99
  • 0

Báo cáo y học: "A standardized scoring method for the copy of cube test, developed to be suitable for use in psychiatric populations" pdf

Báo cáo y học:
... et al.: A standardized scoring method for the copy of cube test, developed to be suitable for use in psychiatric populations Annals of General Psychiatry 2011 10:19 Competing interests The authors ... been developed The aims of the current study were to develop a novel and detailed standardized method of administration and scoring of the copy of the Necker cube test and to preliminarily test ... valuable information might be lost The reversal of the perception of the Necker cube has been extensively studied, but this is not the case concerning its copying To date no standardized method has been...
  • 10
  • 188
  • 0

báo cáo khoa học: " Assessing organisational readiness for change: use of diagnostic analysis prior to the implementation of a multidisciplinary assessment for acute stroke care" doc

báo cáo khoa học:
... interviews, documentary analysis, and a questionnaire to identify team climate can be used to collect data to identify the barriers and facilitators to change Furthermore, such a broad approach to data ... use of a theoretical framework to underpin the diagnostic analysis has resulted in the collection of a far broader range of data than if a purely empirical approach had been taken The broad range ... Specific aims were to identify barriers and facilitators for change to multidisciplinary stroke assessment and to utilise the information obtained to inform a change management approach tailored to...
  • 11
  • 100
  • 0

Báo cáo y học: " Analysis of the replication of HIV-1 forced to use tRNAMet(i) supports a link between primer selection, translation and encapsidation" ppsx

Báo cáo y học:
... 5'aattTAATACGACTCACTATAGGcccggatagctcagtcgg 3' and 5'cgcccgaacagggacttgaaccctgg accctcagattaaaagtctgatgctctaccgactgagctatccgggc 3' (tRNALys,3); 5' aattTAATACGACTCACTATAGGcctcgttagcgcagtagg 3' and ... tgccccgtgtgaggatcgaactcacg accttcagattatgagactgacgcgctacctactgcgctaacgagg (tRNAMet(e)); 5' aattTAATACGACTCACTATAGGagcagagtggcgcagcgg 3' and 5' tagcagaggatggtttcgatccatcg acctctgggttatgggcccagcacgcttccgctgcgccactctgct ... TCTCTAGCAG TGGCGCCCGAACAGGGAC TTGAAAGCG … 3’ HXB2Met(e) 5’ TTTTAGTCAGTGTGG AAAA TCTCTAGCAG TGGTGCCCCGTGTGAGGA TTGAAAGCG … 3’ HXB2Met(i) 5’ TTTTAGTCAGTGTGG AAAA TCTCTAGCAG TGGTAGCAGAGGATGGTT TTGAAAGCG...
  • 14
  • 62
  • 0

Study on corporate governance index of Vietnam commercial bank – the case of a newly established, medium to large joint stock commercial ban

Study on corporate governance index of Vietnam commercial bank –  the case of a newly established, medium to large  joint stock commercial ban
... influenced by the management style of a market economy after privatization The bank is a medium to large joint stock commercial banks in Vietnam For these reasons, corporate governance of the bank is ... out of 44 Vietnam banks - Its performance (ROA) ranked among top 20 banks Secondary information and data of the bank includes the bank annual report, audited financial reports, reports and other ... individual and institutional investors If the bank has intention and plan to go listed (For unlisted banks) If the bank has plan to be listed on international market The benchmark of proportion of shares...
  • 8
  • 129
  • 1

A study on the reality of teaching speaking skill to non english majors at thai nguyen university college of technologyrelevan

A study on the reality of teaching speaking skill to non english majors at thai nguyen university college of technologyrelevan
... communication, the skill of speaking and difficulties in teaching speaking skill 1.1 Nature of Language skills and oral communication 1.1.1 Nature of Language skills For the purpose of analysis and ... using appropriate conversational formulae and filters 1.2 The skill of speaking 1.2.1 The role and status of speaking in language learning and teaching As it was implied in the introduction, the skill ... functioning in a second language The other part of communicative ability that learners in grammar-translation and audio-lingual classes usually lacked was the skill The presupposition that knowledge...
  • 71
  • 703
  • 3


... not the amount of relationships since firms have the help of sophisticated information systems and data warehouses been able to manage a great deal of data The challenge is to capture and measure ... HOW TO MEASURE THE IMPACT OF A CRM STRATEGY ON THE FIRM PERFORMANCE ABSTRACT CRM strategy (Customer Relationship Management) is a business philosophy, stemming from Relationship Marketing that ... 2000; Kaplan and Norton, 1992) They not link the non-financial metrics to financial numbers (e.g Kaplan and Norton, 1992) Traditionally financial and non-financial measures have been seen as opposed,...
  • 15
  • 292
  • 0

Tài liệu A Case Study on the Implementation of A Knowledge Management Strategy Oriented to Innovation pdf

Tài liệu A Case Study on the Implementation of A Knowledge Management Strategy Oriented to Innovation pdf
... success factors in the implementation of KM A Knowledge Management Strategy Oriented to Innovation 167 CASE STUDY Knowledge and Process Management SUCCESS FACTORS IN THE STRATEGY S IMPLEMENTATION The ... technological innovation and the creation, accumulation and transmission of knowledge F J Forcadell and F Guadamillas Knowledge and Process Management CASE STUDY Figure Irizar chart Figure Organizational ... working teams is an essential cultural value At Irizar, participation is the A Knowledge Management Strategy Oriented to Innovation 169 CASE STUDY fundamental task of the normal work: 90% of personnel...
  • 10
  • 557
  • 1

Xem thêm

Từ khóa: Mẫu Quy trình đào tạoGiáo trình phân tích, thiết kế hướng đối tượng bằng UML đoàn văn ban tài liệuHoạt động tập thể tháng 12 lớp 1Luyện nói phát âm l n lớp 1Câu hỏi trọng tâm phần phân tửPhát triển môi trường giao tiếp cho sinh viên sư phạm ở các trường Cao đẳng miền núi phía Bắc (LA tiến sĩ)Phân tích câu về cú pháp dựa vào thuộc tính kết trị của từ (Trên cứ liệu câu động từ tiếng Việt) (LA tiến sĩ)Nghiên cứu, đánh giá thực trạng sản xuất mía nguyên liệu và giải pháp phát triển vùng nguyên liệu mía của Công ty Cổ phần mía đường Lam Sơn Thanh HoáNghiên cứu ảnh hưởng của liều lượng phân Kali trên các nền đạm khác nhau đến sinh trưởng, phát triển và năng suất giống lúa nếp Cái hạt Cau tại huyện Hà Trung, tỉnh Thanh HoáKhả năng vận dụng mô hình công ty mẹ công ty con trong nền kinh tế việt nam tài liệu, ebook, giáo trìnhbai giang TAM SOAT k VUNghiên cứu ứng dụng lý thuyết điều khiển hiện đại xây dựng mô hình trong điều khiển dự báo phi tuyến (LA tiến sĩ)Nghiên cứu thuật toán giảm bậc mô hình và ứng dụng cho bài toán điều khiển (LA tiến sĩ)Đổi mới cơ chế, chính sách đối với doanh nghiệp vừa và nhỏ nhằm thúc đẩy sự phát triển của chúng ở việt nam hiện nay tài liệu, ebook, giáo trìnhGiải pháp kinh tế cho các doanh nghiệp làm ăn thua lỗ tài liệu, ebook, giáo trìnhGiải pháp nâng cao năng lực khuyến nông viên cơ sở tỉnh bắc giang tài liệu, ebook, giáo trìnhNghiên cứu một số đặc điểm dịch tễ học viêm nhiễm dường sinh dục dưới ở phụ nữ nông thôn miền núi tỉnh Thái Nguyên và hiệu quả giải pháp can thiệp (LA tiến sĩ)Hình thái kinh tế xã hội là 1 quá trình lịch sử tự nhiên tài liệu, ebook, giáo trình50 câu trắc nghiệm THI CHỨNG CHỈ TIN học IC3 CHUẨNNghiên cứu đặc điểm cấu trúc và tái sinh tự nhiên của một số quần xã rừng trồng ở khu vực Nhạc Sơn, thành phố Lào Cai, tỉnh Lào Cai (LV thạc sĩ)
Nạp tiền Tải lên
Đăng ký
Đăng nhập