Illustrated key for the identification of brachyuran zoeal stages (crustacea decapoda) in the plankton of peter the great bay (sea of japan)

Illustrated key for the identification of brachyuran zoeal stages (crustacea decapoda) in the plankton of peter the great bay (sea of japan)

Illustrated key for the identification of brachyuran zoeal stages (crustacea  decapoda) in the plankton of peter the great bay (sea of japan)
... 1858 are found only in Possyet Bay (eastern Peter the Great Bay) Brachyuran larvae occur in Peter the Great Bay from April to November Zoea of each species represented in this key has been previously ... also for Paradorippe granulata Different zoeal stages of brachyuran crabs (age distinctions) are easily determined using the number of natatory setae on the exopods of maxillipeds, the number of ... Peter the Great Bay (Russian waters of the Sea of Japan) We found larvae of only 16 species from families and 14 genera occurring in the plankton of Peter the Great Bay (Table 1) To date, we have...
  • 8
  • 50
  • 0

Báo cáo y học: "An optimization framework for unsupervised identification of rare copy number variation from SNP array data." doc

Báo cáo y học:
... other SNP arrays, including earlier versions of the Affymetrix platform, Illumina arrays, or array comparative genomic (a) 2.5 Raw copy number Raw copy number 3.0 hybridization Any platform that ... Birdsuite platform [17] QuantiSNP [26] is an analytical tool for the analysis of copy number variation using whole genome SNP genotyping data It was originally developed for Illumina arrays, but version ... segments of consistent copy number The Affymetrix SNP array was originally designed so that each SNP is interrogated by 24 to 40 unique probes Of these, half are perfectly complementary to the...
  • 18
  • 149
  • 0

key for the phrasal verb(take, look, turn, bring)

key for the phrasal verb(take, look, turn, bring)
... over the capital city and gained control of the government 38 Jim really takes after his father They look the same, they act the same - they even have the same laugh! 39 You thought I stole your ... went down to the beaches near Cape Canaveral to watch the space shuttle take off The launch was magnificent 37 There was a military coup d'etat in the tiny nation The military took over the capital ... 26 They were showing so many commercials during that movie that I finally just got up and turned off the TV 27 The witch turned the handsome prince into a frog 28 Although Sam wanted to keep the...
  • 2
  • 70
  • 0

Báo cáo khoa học: "A Unified Statistical Model for the Identification of English BaseNP" pptx

Báo cáo khoa học:
... conclusions The statistical approach In this section, we will describe the two-pass statistical model, parameters training and Viterbi algorithm for the search of the best sequences of POS tagging ... one of the N-best POS tagging result of the sentence is: T = NN VBD RB CD NNS NN NN For this POS sequence, the 2nd pass will try to determine the baseNPs as shown in Figure The details of the ... possible brackets of "stock was down 9.1 points yesterday morning" Figure 3: the transformed form of the path with dash line for the second pass processing As required in our statistical model, we have...
  • 8
  • 137
  • 0

Báo cáo Y học: The cytoplasmic C-terminus of the sulfonylurea receptor is important for KATP channel function but is not key for complex assembly or trafficking pdf

Báo cáo Y học: The cytoplasmic C-terminus of the sulfonylurea receptor is important for KATP channel function but is not key for complex assembly or trafficking pdf
... complex The data reported here show that the cytoplasmic C-terminus of SUR1 has a key role in channel function but is not absolutely required for complex assembly or trafficking Our data support aspects ... DISCUSSION In this study we report a comprehensive study in a mammalian cell line of the effects of deletion of the SUR1 C-terminus on assembly, trafficking and function of the KATP channel complex ... stimulation by MgADP and diazoxide and support the above hypothesis Sulfonylurea action is more subtly altered The Kd for tritiated glibenclamide binding is not significantly changed However tolbutamide,...
  • 11
  • 78
  • 0

Báo cáo sinh học: " CODEHOP-mediated PCR – A powerful technique for the identification and characterization of viral genomes" pptx

Báo cáo sinh học:
... TTTGACCTGGAGACTATGttymgngartayaa ACCTTCATCAAAAATCCCttnggnggnatgyt GACGACCGCAGCGTGTGCGTGaaygtnttyggnca TAAAAGTACAGCTCCTGCCCGaanacrttnacrca TTAGCTACTCCGTGGAGCagyttrtcraarta GAAGTGGCAGTTGGAGAGGCTGACCTCCcartcncc ... GTGGTCGATTTTGCCAGCCTGTACCCGAGCATCATCCAGGCGCACAACCTGTGC GTAGTAGACTTTGCTAGCCTGTATCCTAGTATTATACAAGCTCATAATCTATGC GTGGTGGACTTTGCCAGCCTGTACCCCACCATCATCCAGGCCCACAACCTCTGC GTAGTGGACTTTGCCAGCCTGTACCCAAGCATTATTCAGGCACACAATCTGTGT GTAGTTGACTTTGCCAGCTTGTACCCCAGCATCATCCAGGCTCATAATCTATGC ... (151aa) CAB61754 (151aa) AAC55648 (55aa) AAD30141 (56aa) AAG23218 (158aa) AAC57974 (151aa) DFASA-GDTD1B AAF23082 (158aa) DFASA-GDTD1B DFASA-GDTD1B DFASA-GDTD1B DFASA-GDTD1B DFASA-GDTD1B DFASA-GDTD1B...
  • 24
  • 126
  • 0

báo cáo hóa học:" CODEHOP-mediated PCR – A powerful technique for the identification and characterization of viral genomes" pptx

báo cáo hóa học:
... TTTGACCTGGAGACTATGttymgngartayaa ACCTTCATCAAAAATCCCttnggnggnatgyt GACGACCGCAGCGTGTGCGTGaaygtnttyggnca TAAAAGTACAGCTCCTGCCCGaanacrttnacrca TTAGCTACTCCGTGGAGCagyttrtcraarta GAAGTGGCAGTTGGAGAGGCTGACCTCCcartcncc ... GTGGTCGATTTTGCCAGCCTGTACCCGAGCATCATCCAGGCGCACAACCTGTGC GTAGTAGACTTTGCTAGCCTGTATCCTAGTATTATACAAGCTCATAATCTATGC GTGGTGGACTTTGCCAGCCTGTACCCCACCATCATCCAGGCCCACAACCTCTGC GTAGTGGACTTTGCCAGCCTGTACCCAAGCATTATTCAGGCACACAATCTGTGT GTAGTTGACTTTGCCAGCTTGTACCCCAGCATCATCCAGGCTCATAATCTATGC ... (151aa) CAB61754 (151aa) AAC55648 (55aa) AAD30141 (56aa) AAG23218 (158aa) AAC57974 (151aa) DFASA-GDTD1B AAF23082 (158aa) DFASA-GDTD1B DFASA-GDTD1B DFASA-GDTD1B DFASA-GDTD1B DFASA-GDTD1B DFASA-GDTD1B...
  • 24
  • 100
  • 0

convergence rates for the tikhonov regularization of coefficient identification problems in elliptic equations

convergence rates for the tikhonov regularization of coefficient identification problems in elliptic equations
... convergence rates for the Tikhonov regularization of the problems of identifying the coefficient q in the Neumann problem for the elliptic equation −div(q∇u) = f in Ω, ∂u q = g on ∂Ω ∂n (0.5) (0.6) and the ... VIETNAM ACADEMY OF SCIENCE AND TECHNOLOGY INSTITUTE OF MATHEMATICS TRẦN NHÂN TÂM QUYỀN Convergence Rates for the Tikhonov Regularization of Coefficient Identification Problems in Elliptic Equations ... ill-posed problems (see [41, 42, 108]) 23 0.4 Summary of the Dissertation In this dissertation we investigate convergence rates for the Tikhonov regularization of the problems of identifying the coefficient...
  • 128
  • 86
  • 0

tóm tắt luận án tiến sĩ convergence rates for the tikhonov regularization of coefficient identification problems in elliptic equations

tóm tắt luận án tiến sĩ convergence rates for the tikhonov regularization of coefficient identification problems in elliptic equations
... we investigate the inverse problems of identifying the coefficient q in the Neumann problem for the elliptic equation −div(q∇u) = f in Ω, ∂u q = g on ∂Ω ∂n (0.1) (0.2) and the coefficient a in the ... methods The authors of these works used the output least-squares method with the Tikhonov regularization of the nonlinear ill-posed problems and obtained some convergence rates under certain source ... Convergence rates for L2 -regularization of the diffusion coefficient identification problem 2.1.1 L2 -regularization For solving the problem of identifying the coefficient q in (0.1)–(0.2) we solve the minimization...
  • 26
  • 130
  • 0

Báo cáo y học: "Identification of an altered peptide ligand based on the endogenously presented, rheumatoid arthritis-associated, human cartilage glycoprotein-39(263–275) epitope: an MHC anchor variant peptide for immune modulation" pot

Báo cáo y học:
... substitutions may function as partial TCR agonists on the one hand and prevent unwanted immune reactivity on the other [32,33] This approach may thus provide an improved option for APL therapy The ... methods Peptides and altered peptide ligands Peptides were synthesised by solid phase peptide synthesis Purity and identity of the peptides were assessed by reverse phase high performance liquid chromatography ... not shown) In conclusion, the analysis of both the hybridoma panel and the polyclonal T cell response to the 263–275 epitope has led to the identification of MHC binding and TCR contact residues...
  • 11
  • 62
  • 0

Báo cáo y học: "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" pptx

Báo cáo y học:
... of all miR loci in the Ciona genome Altogether, miRTRAP generated an apparent false negative rate of approxi- mately 5% and a false discovery rate of approximately 19% To systematically compare ... endogenous human Argonautes and their miRNA partners in RNA silencing Proc Natl Acad Sci USA 2008, 105:7964-7969 33 Katayama S, Tomaru Y, Kasukawa T, Waki K, Nakanishi M, Nakamura M, Nishida H, Yap CC, ... to other genomes will reveal additional novel miRs Materials and methods Library preparation, sequencing and Northern analysis Ciona stage-specific small RNA library preparation and Illumina sequencing...
  • 12
  • 167
  • 0

Báo cáo y học: "Dermoscopy as a technique for the early identification of foot melanoma" pot

Báo cáo y học:
... skin A videomicroscopic analysis Arch Dermatol 1998, 134:563-568 Saida T, Miyazaki A, Oguchi S, Ishihara Y, Yamazaki Y, Murase S, Yoshikawa S, Tsuchida T, Kawabata Y, Tamaki K: Significance of ... clinical diagnosis Arch Dermatol 1995, 131:298-304 Saida T, Yoshida N, Ikegawa S, Ishihara K, Nakajima T: Clinical guidelines for the early detection of plantar malignant melanoma J Am Acad Dermatol ... primary care physicians In the UK, courses have been running for a number of years and include a range of health care practitioners The most recent meta analysis of dermoscopy [36] has encompassed...
  • 6
  • 162
  • 0

báo cáo khoa học: " Whole-Organ analysis of calcium behaviour in the developing pistil of olive (Olea europaea L.) as a tool for the determination of key events in sexual plant " ppsx

báo cáo khoa học:
... showed the accumulation of Ca/Sb precipitates in the vacuoles of the stigma cells as well as in the intracellular spaces between them The stigmatic surface is the main place for signal exchange ... precipitates The spectrum of the material reveals peaks for Ca and Sb The strong decrease of the Ca2+ pool in the pistil at the last stages of pistil development coincides with the degradation of the ... 3-fold in comparison with that found in stage A more detailed analysis of the changes in the olive pistil Ca2+ pool was performed using the separated parts of the pistil: stigma with style and ovary...
  • 12
  • 156
  • 0

Xem thêm

Từ khóa: aquatic toxicity for hazard identification of metals and inorganic metal substancesprinciples guiding screening for early identification of mental health and substance use problems in children and adolescentscharacterization of additives for source identification of refined productsevidence for the u s europe and japana unified statistical model for the identification of english basenp2 where the customer has not been physically present for identification purposes a relevant person must take specific and adequate measures to compensate for the higher risk for example by applying one or more of the following measures—multi agent methods an example of an architecture and its application for the detection recognition and identification of targetsthe use of multiplex pcr and an adapted hplc method for identification of mycobacterium bovis and diagnosis of bovine tuberculosistesting for the presence of a key in a hashaureus identification for the nuc or fema gene and detection of the meca for methicillin resistancea rational strategy for the identification and testing of new agentsidentification of desirable and feasible changes for the systeman evaluation of the evidence for linkages between mangroves and fisheries a synthesis of the literature and identification of research directionstechnique named mgk monitoring of gene knockouts for genome wide identification of conditionally essential genes mgk identified bacterial genes that are critical for fitness in the absenceand there is an immediate need for the development of novel and more effective therapeutic modalities against this deadly diseaseCaroline Da Silva PresentationCEEC Education Presentation In English1Chuyên Đề: Thanh Tra, Kiểm Tra Trong Giáo DụcGlobal Effect sof the Great DepressionBài 38 phát triển tổng hợp kinh tế và bảo vệ tài nguyên, môi trường biển đảoTương Đương Sinh Học Trong Đăng Ký ThuốcKaplan Financial Adviser EducationICA Apresentation NSFPC210icab capa keynote paperChuyên Đề: Tình Yêu Quê Hương, Đất Nước, Con Người Qua Ca Dao, Dân Cajohn mc creery AAII BaltimoreFinal Jive Communications - Leverage Technology to Enhance BrandingGDP Powerpoint 2011-2012Bài 4 các quốc gia cổ đại phương đông (2)advansys formativ overviewDự án: Hỗ trợ hòa nhập Kinh tế Xã hội và Việc làm cho Người khuyết tật tại Việt NamHR TRENDING TO THE FUTURE Jo Pryce FINALCBBC Liability Presentation 071616 Final NcgfoaMacro- And Structural Changes In The European Economy, 1290 - 1520Sự Phát Triển Của Khoa Học-Kĩ Thuật Và Văn Hóa Thế Giới Nửa Đầu Thế Kỉ XX
Nạp tiền Tải lên
Đăng ký
Đăng nhập