common collocations with get 20 idioms

FOCUS ON - phrasal verbs with get, 1

FOCUS ON -  phrasal verbs with  get,  1
... There was an accident on the highway, and no one could get by get by (on) p.v When you get by or get by on a certain amount of money, you continue with your work or continue with your life even ... would be fun try on try on & tries on trying on tried on tried on try on p.v When you try on an item of clothing before deciding whether you will buy it or borrow it from someone in order to ... sentences with these phrasal verbs from previous sections Be sure the phrasal verbs are in the correct tense To check their meanings, review the section number given after each one break inlinto, 41...
  • 27
  • 679
  • 1

First Certificate language practice with key 20 pot

First Certificate language practice with key 20 pot
... succeeded owing to her hard work (verb + owing to) Grammar 13 and the first part of this unit cover linking words that join clauses within a sentence There are also linking words that join ideas across ... order the points we are making First (of all) , Secondly , Next , Then , Finally/lastly/last of all In narrative, the sequence of events can be introduced by: First , Then , After that , Finally/in ... comparison • Summarizing We can summarize all the points we have made In conclusion , To sum up 187 FIRST CERTIFICATE L A N G U A G E P R A C T I C E Underline the most suitable w o r d or phrase in...
  • 10
  • 219
  • 0

Mỗi ngày 20 idioms

Mỗi ngày 20 idioms
... trở lòng bàn tay 12 to lay off: sa thải - The company laid off 20 workers yesterday Now they have no job Công ty sa thải 20 công nhân ngày hôm qua Hiện họ việc làm 13.And pigs might fly: lâu được, ... told me that you are going to break up with Rachel Có người nói riêng cho biết anh Rachel chia tay 20 A pain in the neck: nợ, người làm phiền, "kỳ đà cản mũi" - Everytime I play chess with my Dad,...
  • 3
  • 180
  • 0

collocations with prepositions

collocations with prepositions
... depend on (someone) for (something) discuss (something) with (someone) distinguish (something) from (something else) dream about/of (someone/something) ... ([doing] something) get rid of (something) graduate from (a place) happen to (someone) help (someone) with (something) hide (something) from (someone) insist (up)on (something) introduce (someone) to ... prohibit (someone) from ([doing] something) protect (someone) from (something) provide (someone) with (something) recover from (something) rely (up)on (someone/something) remind (someone) of (something)...
  • 4
  • 370
  • 2

Báo cáo toán học: "Nonabelian Groups with (96, 20, 4) Difference Sets Omar A. AbuGhneim" ppt

Báo cáo toán học:
... 2) difference sets to construct images (96, 20, 4) difference sets in groups of order 32 and then used those images to construct (96, 20, 4) difference sets in GAP[96,221] and GAP[96,231] The difference ... possible (96, 20, 4) difference sets in some 72 groups groups of order 96, those groups that have both factor groups of order 32 and 24 Table lists the Groups of order 96 which admit a (96, 20, 4) difference ... results with the results that have been done before we have 90 groups of order 96 that admit (96, 20, 4) difference sets We have 121 groups that not admit (96, 20, 4) difference sets We have 20 groups...
  • 17
  • 66
  • 0

báo cáo khoa học: "Nodulin 41, a novel late nodulin of common bean with peptidase activity" pot

báo cáo khoa học:
... ataatatatatatatatatataataataataataataataataatatgatatatatgtatgtgtaaaataaagaa aagagaatgtataagcgtatggtttctttgcaagaagagcattactgagattggtatg 75 13 150 38 225 63 300 88 AEM05966.1) composed of a single ... cgttcatgcctaccacatgtcgttcacaaccatgcaccttactcctccctgaacaaaaaggatgtggaaaatcag T F M P T T C R S Q P C T L L L P E Q K G C G K S (P-2) S gtgaatgcatctacacatacaaatacggtgaccaatattcattcagcgaagggcttttgagtaccgaaaccctaa ... cactctcacccttctacaacccttccctcaccccatcacagcgcatcataaacgctgccctgcgctccatttctc P L S P F Y N P S L T P S Q R I I N A A L R S I S gactaaaccgagtttctaacctcctagatcaaaacaacaaactaccccaatcagttttgatcctacacaacggtg...
  • 14
  • 103
  • 0


... before than Incorrect: A horse is usefuller than a car Correct: A horse is more useful than a car Adjectives and adverbs having more than one syllable form their comparative and superlative forms...
  • 2
  • 60
  • 0

Xem thêm

Nạp tiền Tải lên
Đăng ký
Đăng nhập