5 forms of the verb 20 phrasal verbs movement

Choose the correct forms of the verb potx

Choose the correct forms of the verb potx
... living here for years are has has been have been - They _ on the project at the moment working be working is working are working - Do you still _ to the tennis club? belongs are belong belonging ... works - I to a great radio show on the way to work listening to listening have listening was listening - Tom's not here He's out _ his mother visit visited visiting is visiting - She ... see has see seen seeing - I _ football after work play to play playing am play 10 - We _ a lot of volunteer work are doing does ...
  • 4
  • 182
  • 0

Give correct forms of the verbs

Give correct forms of the verbs
... next week, he (see) the Eiffel Tower 46 I myself (witness) an accident on the Main Road yesterday A boy (knock) down by a car Then he (take) to the nearest hospital 47 Most of the Earth’s surface ... first as I (not get up) so early 66 Cuckoos (not build) nests They (use) the nests of other birds 67 I (wear) my sunglasses today because the sun is very strong 68 I wish that dog (lie down) He (keep) ... (feel) something hit me in the back I (not know) what it was 72 When I (see) the man, he (stand) outside the bank He (have)a cap on 73 When I (open) the cupboard door, a pile of books (fall) out 74...
  • 2
  • 297
  • 2

Tenses and forms of the verbs (very hot)

Tenses and forms of the verbs (very hot)
... 107 They will pass the exam if they (study)…………….hard 108.They said that they (will try)……………… their best to the test 109 .The kids (sleep)………………when the bell rang 110.She (eat)……………a lot of fruit ... 43- They had to cancel the flight because of the bad weather The flight 44- We must finish the project on time The project 45- People can find a cure for cancer in the ... arrived late for the concert Despite 10- It's a pity our teacher isn't here at the moment I wish 11- They'll have to change the date of the meeting again The date ...
  • 8
  • 225
  • 8

TOPIC 3 FORMS OF THE VERBS

TOPIC 3  FORMS OF THE VERBS
... them 33 We began (talk)…………………………… about next year’s holiday two months ago 34 I remember (lock)………… the door when I left but forgot (shut) ………… the window 35 He agrees (start)…………………………… the ... yet? 30 We decided (rent)……………………… a house with a swimming pool 31 Can you help me (get) …………………… the dinner ready? 32 When we arrived, the people next door invited us (have)……………a drink with them ... possible 36 I finished (read)………………………… the book and went to bed 37 My teachers always expected me (do)………………………………… well in exams 38 Let me (pay) ………………………………… for the meal You paid last time 39 I...
  • 3
  • 174
  • 3

Tài liệu MARKETING APPLE 5 SECRETS OF THE WORLD''''S BEST MARKETING MACHINE pptx

Tài liệu MARKETING APPLE 5 SECRETS OF THE WORLD''''S BEST MARKETING MACHINE pptx
... Well APPLE DOESN’T HAVE SOME special place where their marketing secrets are kept, unless of course you count their charismatic CEO’s brain The five secrets I offer here are careful ... engineers they are a pure Apple marketing trick designed to make the visible part of their product a status symbol Wear white This eBook courtesy of Steve Chazin, former Apple, Inc sales and marketing ... tricks you can apply to help your business Learn some of the marketing secrets that propelled Apple from the backwaters of the PC market to the worldwide leader in consumer electronics, music,...
  • 8
  • 221
  • 0

Báo cáo khoa học: Characterization of recombinant forms of the yeast Gas1 protein and identification of residues essential for glucanosyltransferase activity and folding pot

Báo cáo khoa học: Characterization of recombinant forms of the yeast Gas1 protein and identification of residues essential for glucanosyltransferase activity and folding pot
... influence the protonation state of the carboxyl group of their side-chain [7] The aim of the present study was to express Gas1p at high levels for biochemical and structural characterization of the protein ... acid residues are essential for the two-step activity (Fig 6B,C) In addition, the sGas1482-H protein was analyzed for activity before and after removal of the N-linked chains by Endo H The complete ... wild-type Gas1p or the Gas1- C74S mutant were labelled for with [35S]methionine and the behaviour of the labelled forms was monitored at different time-points after the chase (Fig 7B) The ER form of Gas1p...
  • 11
  • 202
  • 0

Báo cáo khoa học: Inactive forms of the catalytic subunit of protein kinase A are expressed in the brain of higher primates potx

Báo cáo khoa học: Inactive forms of the catalytic subunit of protein kinase A are expressed in the brain of higher primates potx
... TGCCATGAAGATCTTAGA TGAGCAGTACTACGCCATGA GTAGCCCTGCTGGTCAATGA TTCCGTAGAAGGTCCTTGAG (VII) TTCCGTAGAAGGTCCTTGAG (VII) CCTAATGCCCACCAATCCA (VI) TTCCGTAGAAGGTCCTTGAG (VII) TTCCGTAGAAGGTCCTTGAG (VII) CTAATCTATGAAATGGCAG ... band seen in NT2-N cells is present in brain, but not in PBL (Fig 3A, lanes and 3) To examine whether the CbD4 variants were expressed in different parts of the brain as well as in fetal brain, ... was carried out using the Cb common primer pair on cDNA from hippocampus, amygdala and cerebral cortex of human adult brain, and on cDNA from human fetal brain Cb was barely detectable in fetal...
  • 13
  • 156
  • 0

Xem thêm

Từ khóa: 22 Đề thi toán tuyển sinh vào lớp 10 các tỉnhthành phố ( có đáp án ) năm học 20172018tiểu luận lý luận nhà nước và pháp luật (đề tài quá trình hình thành của Viện kiểm sát nhân dân Việt Nam)Hoàn thiện quản lý đánh giá thực hiện công việc của người lao động tại Công ty cổ phần Viglacera Hạ Long (LV thạc sĩ)Một số bài toán cực trị cho đa thức nhiều biến (LV thạc sĩ)Hoàn thiện công tác thanh tra, kiểm tra thuế đối với doanh nghiệp tại Chi cục Thuế huyện Tân Sơn, tỉnh Phú Thọ (LV thạc sĩ)Quản lý rủi ro tín dụng tại Ngân hàng thương mại cổ phần Đầu tư và Phát triển Việt Nam Chi nhánh tỉnh Phú Thọ (LV thạc sĩ)SÁNG KIẾN KINH NGHIỆM PHƯƠNG PHÁP TỨ GIÁC NỘI TIẾPCHIẾN LƯỢC PHÁT TRIỂN TRƯỜNG THCS GHỀNH RÁNG GIAI ĐOẠN 2010 2020đề tài: Nâng cao kĩ năng làm văn nghị luận về tác phẩm, đoạn trích văn xuôi cho học sinh lớp 12 trường trung học phổ thôngbài tập chuyên đề con lắc đơnQuản lý hoạt động giáo dục cho thanh thiếu niên thông qua khóa học hè tại các cơ sở Phật giáo thành phố Hải Dương (LV thạc sĩ)Khoá luận tốt nghiệp đại học chuyên ngành khoa học môi trường đánh giá hiện trạng ô nhiễm nước thải hầm lò mỏ than tại công ty TNHH MTV 790Phát triển nguồn nhân lực đáp ứng yêu cầu công nghiệp hóa, hiện đại hóa ở thành phố Việt Trì, tỉnh Phú Thọ (LV thạc sĩ)Hoàn thiện quản lý ngân sách nhà nước trên địa bàn phường Thọ Sơn, thành phố Việt Trì, tỉnh Phú Thọ (LV thạc sĩ)Nghiên cứu một số thuật toán lọc thư rác và ứng dụng trong lọc email nội bộ của viễn thông tỉnh Bắc Kạn (LV thạc sĩ)Chất lượng công chức ngành lao động phúc lợi xã hội thủ đô viêng Chăn, nước cộng hòa dân chủ nhân dân Lào (LV thạc sĩ)Thực hiện văn hóa công sở tại bộ tài nguyên và môi trường, nước Cộng hòa dân chủ nhân dân Lào (LV thạc sĩ)DE CUONG QUAN LY HANH CHINH NHA NUOCSKKN: Một số kinh nghiệm trong tổ chức thực hiện Mô hình “Em yêu Biển đảo Việt Nam”Huy động cộng đồng dân cư trong giám sát, bảo vệ môi trường tại thành phố tuy hòa, tỉnh phú yên
Nạp tiền Tải lên
Đăng ký
Đăng nhập