5 forms of the verb 20 phrasal verbs movement

Choose the correct forms of the verb potx

Choose the correct forms of the verb potx
... living here for years are has has been have been - They _ on the project at the moment working be working is working are working - Do you still _ to the tennis club? belongs are belong belonging ... works - I to a great radio show on the way to work listening to listening have listening was listening - Tom's not here He's out _ his mother visit visited visiting is visiting - She ... see has see seen seeing - I _ football after work play to play playing am play 10 - We _ a lot of volunteer work are doing does ...
  • 4
  • 176
  • 0

Give correct forms of the verbs

Give correct forms of the verbs
... next week, he (see) the Eiffel Tower 46 I myself (witness) an accident on the Main Road yesterday A boy (knock) down by a car Then he (take) to the nearest hospital 47 Most of the Earth’s surface ... first as I (not get up) so early 66 Cuckoos (not build) nests They (use) the nests of other birds 67 I (wear) my sunglasses today because the sun is very strong 68 I wish that dog (lie down) He (keep) ... (feel) something hit me in the back I (not know) what it was 72 When I (see) the man, he (stand) outside the bank He (have)a cap on 73 When I (open) the cupboard door, a pile of books (fall) out 74...
  • 2
  • 288
  • 2

Tenses and forms of the verbs (very hot)

Tenses and forms of the verbs (very hot)
... 107 They will pass the exam if they (study)…………….hard 108.They said that they (will try)……………… their best to the test 109 .The kids (sleep)………………when the bell rang 110.She (eat)……………a lot of fruit ... 43- They had to cancel the flight because of the bad weather The flight 44- We must finish the project on time The project 45- People can find a cure for cancer in the ... arrived late for the concert Despite 10- It's a pity our teacher isn't here at the moment I wish 11- They'll have to change the date of the meeting again The date ...
  • 8
  • 212
  • 8


... them 33 We began (talk)…………………………… about next year’s holiday two months ago 34 I remember (lock)………… the door when I left but forgot (shut) ………… the window 35 He agrees (start)…………………………… the ... yet? 30 We decided (rent)……………………… a house with a swimming pool 31 Can you help me (get) …………………… the dinner ready? 32 When we arrived, the people next door invited us (have)……………a drink with them ... possible 36 I finished (read)………………………… the book and went to bed 37 My teachers always expected me (do)………………………………… well in exams 38 Let me (pay) ………………………………… for the meal You paid last time 39 I...
  • 3
  • 134
  • 1


... Well APPLE DOESN’T HAVE SOME special place where their marketing secrets are kept, unless of course you count their charismatic CEO’s brain The five secrets I offer here are careful ... engineers they are a pure Apple marketing trick designed to make the visible part of their product a status symbol Wear white This eBook courtesy of Steve Chazin, former Apple, Inc sales and marketing ... tricks you can apply to help your business Learn some of the marketing secrets that propelled Apple from the backwaters of the PC market to the worldwide leader in consumer electronics, music,...
  • 8
  • 195
  • 0

Báo cáo khoa học: Characterization of recombinant forms of the yeast Gas1 protein and identification of residues essential for glucanosyltransferase activity and folding pot

Báo cáo khoa học: Characterization of recombinant forms of the yeast Gas1 protein and identification of residues essential for glucanosyltransferase activity and folding pot
... influence the protonation state of the carboxyl group of their side-chain [7] The aim of the present study was to express Gas1p at high levels for biochemical and structural characterization of the protein ... acid residues are essential for the two-step activity (Fig 6B,C) In addition, the sGas1482-H protein was analyzed for activity before and after removal of the N-linked chains by Endo H The complete ... wild-type Gas1p or the Gas1- C74S mutant were labelled for with [35S]methionine and the behaviour of the labelled forms was monitored at different time-points after the chase (Fig 7B) The ER form of Gas1p...
  • 11
  • 197
  • 0

Báo cáo khoa học: Inactive forms of the catalytic subunit of protein kinase A are expressed in the brain of higher primates potx

Báo cáo khoa học: Inactive forms of the catalytic subunit of protein kinase A are expressed in the brain of higher primates potx
... TGCCATGAAGATCTTAGA TGAGCAGTACTACGCCATGA GTAGCCCTGCTGGTCAATGA TTCCGTAGAAGGTCCTTGAG (VII) TTCCGTAGAAGGTCCTTGAG (VII) CCTAATGCCCACCAATCCA (VI) TTCCGTAGAAGGTCCTTGAG (VII) TTCCGTAGAAGGTCCTTGAG (VII) CTAATCTATGAAATGGCAG ... band seen in NT2-N cells is present in brain, but not in PBL (Fig 3A, lanes and 3) To examine whether the CbD4 variants were expressed in different parts of the brain as well as in fetal brain, ... was carried out using the Cb common primer pair on cDNA from hippocampus, amygdala and cerebral cortex of human adult brain, and on cDNA from human fetal brain Cb was barely detectable in fetal...
  • 13
  • 150
  • 0

Xem thêm

Từ khóa: Nhận dạng tự động tiếng nói phát âm liên tục cho các phương ngữ chính của tiếng Việt theo phương thức phát âmcương ôn thi TN anh văn THPT 2017)chiến lược marketing bitisEbook Inorganic chemistry (2nd edition) Part 2LHS vũ thị phượng biện pháp tư pháp trả lại tài sản sửa chữa hoặc bồi thường thiệt hại theo bộ luật hình sự năm 1999Nghiên cứu vai trò độ mịn của xỉLQT dương thị thu thảo các quy định của pháp luật thương mại quốc tế liên quan đến vấn đề bảo vệ môi trườngNghiên cứu tiềm năng và thực trạng phát triển ngành nông nghiệm tỉnh sơn laThuyết trình môn luật hình sự đề tài tội phạm giết ngườikhảo sát ảnh hưởng của tần số rung đến độ điền đầy và tổ chức tế vi hợp kim adc12 trong đúc mẫu hóa khíBÀI báo GIAN lận báo cáo tài CHÍNH THỰC TRẠNG và GIẢI PHÁPBảo vệ quyền con người trong bốn công ước geneva về việc bảo hộ nạn nhân chiến tranhThực hành quyền công tố và kiểm sát điều tra các tội xâm phạm sức khỏe trên địa bànLabor relations and collective bargaining private and public sectorsInformation technology project management 7th schwalbeFoodservice management principles and practices 13th global edition palacio theisElectric circuits 10th nilssonQualitative research methods for the social sciences 9th lune bergThỏa thuận thi hành án dân sự theo pháp luật thi hành án dân sự việt nam hiện hànhSocial psychology 14th global edition branscombe baron
Nạp tiền Tải lên
Đăng ký
Đăng nhập