role play a very big family esl1

role play a very big family esl1

role play a very big family esl1
... Banana.com Test Your Speaking & Listening Skills Role Playing - Family Tania: Hello, Jeff How are you doing? Jim: This is Tony and Robert They’re twins And this is Stephen He’s a farmer Tania: ... I’m pleased to meet you Jim: Lewis is my eldest brother Tania: Hi, Lewis Jim: And Pete and Herbert are also my brothers Tania: Hello, Pete Hi, Herbert Wow! I can’t believe you’ve got so many brothers ... many brothers and sisters! Jim: Yes, I love it We all get on really well Do you have any brothers or sisters? Tania: No, I don’t I’m an only child For more fun tests, quizzes and games log onto...
  • 2
  • 10
  • 0

Báo cáo khoa học: Trigger factor interacts with the signal peptide of nascent Tat substrates but does not play a critical role in Tat-mediated export pptx

Báo cáo khoa học: Trigger factor interacts with the signal peptide of nascent Tat substrates but does not play a critical role in Tat-mediated export pptx
... on the export of proteins that follow disparate targeting/translocation pathways In conclusion, the data suggest that TF, although interacting with Tat signal peptides, does not play a critical ... SufIHAXbaI+ClaI-rv (5¢-ACTGATCGATCTAGATTACGCAT AGTCAGGAACATCGTATGGGTAGCCGCCTGGCG GTACCGGATTGACCAAC-3¢, ClaI site underlined, XbaI site in italics, HA-epitope sequence in boldface) The resulting fragments ... pC4Meth-100TorA/P2 was constructed by PCR, using pTorA/P2 [17] as a template and the primers RRTorA-SacI-fw (5¢-GCGCGGAGCTCAAGAAGGA AGAAAAATAATGAAC-3¢, SacI site underlined) and TorA/Lep2-BamHI-rv (5¢-GCATGGATCCCGCGCGC...
  • 9
  • 148
  • 0

Báo cáo khoa học: Nuclear aggregates of polyamines are supramolecular structures that play a crucial role in genomic DNA protection and conformation potx

Báo cáo khoa học: Nuclear aggregates of polyamines are supramolecular structures that play a crucial role in genomic DNA protection and conformation potx
... Polyamine aggregates and DNA L D’Agostino et al Fig Interaction of single nuclear aggregates of polyamines (NAPs) with different DNA forms (A) Small-size NAP (s-NAP) interacting with A- DNA Grey ... 2005 FEBS L D’Agostino et al Polyamine aggregates and DNA A B Fig Nuclear aggregates of polyamines (NAPs) protect genomic DNA from DNase I and, at the same time, in uence DNA conformation The electrophoretic ... the charge attraction between DNA phosphates and the amino groups of polyamines As the amino groups of polyamines are already engaged in ionic bonds with the phosphates of NAPs, secondary amino...
  • 11
  • 159
  • 0

Báo cáo Y học: Does phosphorylation of the cap-binding protein eIF4E play a role in translation initiation? ppt

Báo cáo Y học: Does phosphorylation of the cap-binding protein eIF4E play a role in translation initiation? ppt
... 5357 an anabolic stimulus, may largely induce increased translation across the board of mRNAs that are already actively being translated How could increased phosphorylation of eIF4E actually inhibit ... i.e has a cap and a poly (A) -tail The open reading frame of the mRNA is shown as a thick line Initiation factors are abbreviated The arrow indicates the phosphorylation of eIF4E at Ser209 by the ... by the observations (a) that insulin activates protein synthesis in the absence of an increase in eIF4E phosphorylation [48] and (b) that the S20 9A mutant can support protein synthesis [64] In...
  • 10
  • 141
  • 0

Khóa luận tốt nghiệp tiếng anh: A study on using Role Play to motivate the 10th form students in speaking lessons at Lao Cai boarding upper secondary school, Lao Cai province –An experiment

Khóa luận tốt nghiệp tiếng anh: A study on using Role Play to motivate the 10th form students in speaking lessons at Lao Cai boarding upper secondary school, Lao Cai province –An experiment
... Role Play to motivate the 10th form students in speaking lessons at Lao Cai boarding upper secondary school, Lao Cai province –An experiment. ” 1.2 Hypothesis Using role play can increase students ... namely A study on using Role Play to motivate the 10th form students in speaking lessons at Lao Cai boarding upper secondary school, Lao Cai province –An experiment. The experiment lasted seven ... ABSTRACT The purpose of this study was to investigate the effects of using role play to motivate students in speaking lesson The research was carried out at Lao Cai boarding upper secondary...
  • 92
  • 937
  • 4

Báo cáo hóa học: " Homologous recombination is unlikely to play a major role in influenza B virus evolution" doc

Báo cáo hóa học:
... showed that homologous < /b> recombination < /b> in < /b> influenza < /b> B viruses was very rare or absent and could not confer a < /b> substantial fitness advantage Therefore, we conclude that homologous < /b> recombination < /b> is < /b> unlikely < /b> ... H, Spackman E, Alexander DJ: Recombination < /b> resulting in < /b> virulence shift in < /b> avian influenza < /b> outbreak, Chile Emerg Infect Dis 2004, 10:693-699 Gibbs MJ, Armstrong JS, Gibbs AJ: Recombination < /b> in < /b> the ... for the "recombinants" detected here is < /b> contamination by influenza < /b> virus derived PCR products, which could combine during PCR amplification to < /b> generate apparent, but artifactual recombinants None...
  • 3
  • 69
  • 0

báo cáo hóa học:" Spontaneous regression of curve in immature idiopathic scoliosis - does spinal column play a role to balance? An observation with literature review" pot

báo cáo hóa học:
... doi:10.1186/174 9-7 99X- 5-8 0 Cite this article as: Modi et al.: Spontaneous regression of curve in immature idiopathic scoliosis - does spinal column play a role to balance? An observation with literature review ... final approval, JYH has contributed in acquisition of data and analysis and interpretation of data; and KPV and NM have contributed in revising the manuscript critically All authors read and approved ... differential pressure loading on the growth plate [31] Eular’s Law of viscoelastic buckling of a spine in the coronal and transverse planes Page of leading to a lateral bend and axial rotation/torsional...
  • 8
  • 131
  • 0

Family is a very good school doc

Family is a very good school doc
... must have a general knowledge in order that she can satisfy her child’s thirst for knowledge From this point of view, family is the very base of the school education Family is a good school Family ... right in a country, which always pays close attention to the role of the family and regards family as a basic unit of society But in the society where family is not considered as the foundation ... family to the education of children It also justifies that the education which a child gets from his family is not less important than the knowledge he obtains at school The above sentence is...
  • 5
  • 106
  • 0

Báo cáo khoa học: "SemiPro-inflammatory cytokines play a key role in the development of radiotherapy-induced gastrointestinal mucositis" pptx

Báo cáo khoa học:
... 5’-GTGCATCATCGCTGTTCATACA TNF Forward: 5’-GTGATCGGTCCCAACAAG-3’ Results 71 X66539 Reverse: 5’-AGGGTCTGGGCCATGGAA-3’ b actin Forward: 5’-AGGCCAACCGTGAAAAGATG-3’ 101 NM_031144 Reverse: 5’-ACCAGAGGCATACAGGGACAA-3’ ... weeks of radiotherapy Staining was variable between the basal and apical regions of the crypts and did not significantly change of the course of radiotherapy (Data not shown) IL-6 IL-6 staining was ... that had received no radiotherapy There was an increase in protein expression of TNF after radiotherapy, particularly after 22.5 Gy and 30 Gy as indicated by the arrow, although the staining was...
  • 8
  • 121
  • 0

Báo cáo y học: " Media and education play a tremendous role in mounting AIDS awareness among married couples in Bangladesh" potx

Báo cáo y học:
... (National Institute of population research and Training), Mitra and Associates and ORC Macro In 'Bangladesh Demography and Health Survey 2003–2004' Dhaka and Calverton: NIPORT, Mitra and Associates and ... than agricultural self employed males Broadcast media like radio, TV have tremendous reach and influence and play a vital role to build up awareness against HIV /AIDS in the community [17,18] According ... program planning, implementation, monitoring and evaluation regarding AIDS awareness In this regards a few national and international researchers have made attempts to understand the reasons and...
  • 7
  • 146
  • 0

báo cáo khoa học: " Do mitochondria play a role in remodelling lace plant leaves during programmed cell death?" pps

báo cáo khoa học:
... modification during programmed cell death in lace plant, Aponogeton madagascariensis (Aponogetonaceae) Am J Bot 2007, 94:1116-1128 Gunawardena AHLAN: Programmed cell death and tissue remodeling in plants ... Fukuda H: Programmed cell death of treachery elements as a paradigm in plants Plant Mol Biol 2000, 44:245-253 Fakuda H, Watanabe Y, Kuriyama H, Aoyagi S, Sugiyama M, Yamamoto R, Demura T, Minami A: ... developing lace plant leaves was also indirectly examined via CsA pre-treatment Examination of CsA treated mitochondria revealed individual organelles, continued mitochondrial streaming and no loss in...
  • 18
  • 49
  • 0

Báo cáo y học: "c-Fms-mediated differentiation and priming of monocyte lineage cells play a central role in autoimmune arthritis" docx

Báo cáo y học:
... cells are aberrantly activated: an increase in macrophage infiltration Page of 15 of the synovium promotes inflammation via the production of TNF and other proinflammatory cytokines, and an increase ... differentiation and priming of monocyte lineage cells play a central role in autoimmune arthritis Arthritis Research & Therapy 2010 12:R32 Submit your next manuscript to BioMed Central and take full advantage ... likely results in part from an increase in PDGFR expression and activity [46] In addition, PDGFR signaling may promote synovitis in RA by inducing the production of proinflammatory cytokines by...
  • 15
  • 93
  • 0

Running and adult neurogenesis does septohippocampal sonic hedgehog play a role

Running and adult neurogenesis does septohippocampal sonic hedgehog play a role
... Collateral pathway and contralateral CA3 and CA1 pyramidal cells via the Associational/Commissural fibres Another extrahippocampal source of input to the DG and CA3 comes from the medial septum and ... closely associated with locomotion (Bland and Vanderwolf, 1972; Kramis et al., 1975; Vanderwolf, 1969; Vanderwolf and Heron, 1964) Schaffer collaterals CA1 Associational/ Commissural fibres Perforant ... increase in neurogenesis (van Praag et al., 199 9a; van Praag et al., 1999b) It does not merely facilitate cellular plasticity, it also brings about a host of beneficial brain changes at various...
  • 212
  • 33
  • 0

A study on the use of role play to improve speaking skill for the second year tourism students at nghe an trading and tourism vocationl college

A study on the use of role play to improve speaking skill for the second year tourism students at nghe an trading and tourism vocationl college
... and to know that role play improve the students speaking skill So that we -the teachers of Nghe An Trading and Tourism Vocational College – can implement in teaching speaking to our tourism students ... because the main target in learning a foreign language is in speaking ability Based on the researcher’s observation, the speaking ability of the second year tourism students at Nghe An Trading and ... the role playing and simulation, games, role play, simulation-game, role play simulation, and role playing game There seem to be some agreement; however, simulation is a broader concept than role...
  • 73
  • 102
  • 1

Xem thêm

Đăng ký
Đăng nhập