SolidPhase Synthesis of Tetrahydro1,4 benzodiazepine2one Derivatives as a βTurn Peptidomimetic Library
A study of using english songs as a type of supplementary material in teaching listening for first year non major students of english at phuong dong university
... interest students in listening lessons That is the reason why this paper is made a study of using English songs as a kind of supplementary material in teaching listening skill to first year non- major ... OF USING SONGS AS A SUPPLEMENTARY MATERIAL IN TEACHING LISTENING FOR THE FIRST- YEAR NON- MAJOR STUDENTS OF ENGLISH AT PHUONG DONG UNIVERSITY 2.1 Hypothesis: As presented above, this study was ... such as filling in the blanks 3.3 IMPLICATION IN USING ENGLISH SONGS IN TEACHING LISTENING SKILL 3.3.1 How to use songs as supplementary materials? As said above the main purpose for using songs...
- 39
- 1,125
- 3
Tài liệu The Value of the Case Study as a Research Strategy doc
... re-evaluation of cases Reliability is most important during the data collection phase, and involves the use of case study protocol as well as the case study database already mentioned Validity and ... underlying the case study itself is of a holistic nature Case studies may either focus on a single case or use a number of cases: A single case may form the basis of research on typical, critical or ... in an Administrative Science Quarterly article titled 'Qualitative data as an attractive nuisance' that research based upon case study was unlikely to transcend story-telling Is case study a valid...
- 15
- 587
- 0
Báo cáo khoa học: Alternative splicing: regulation of HIV-1 multiplication as a target for therapeutic action docx
... UUAGGACAUAUAGUUAGCCCUAGG unknown UGGGU CUAGACUAGA CCAGUAGAUCCUAGACUAGA GAAGAAGCGGAGACAGCGACGAAGA AGAUCCAUUCGAUUAG unknown UAGUGAAUAGAGUUAGGCAGGGA GAAGAAGAA UAGAAGAAGAA 4995–5017 [5, 12, 38, 40] 5362–5366 ... coactivators J Virol 76, 9724–9734 HIV-1 alternative splicing regulation 34 Kuramitsu M, Hashizume C, Yamamoto N, Azuma A, Kamata M, Yamamoto N, Tanaka Y & Aida Y (2005) A novel role for Vpr of ... cells Proc Natl Acad Sci USA 91, 7311–7315 32 Kamata M, Nitahara-Kasahara Y, Miyamoto Y, Yoneda Y & Aida Y (2005) Importin-alpha promotes passage through the nuclear pore complex of human immunodeficiency...
- 10
- 434
- 0
Báo cáo khoa học: Identification of carbonic anhydrase 9 as a contributor to pingyangmycin-induced drug resistance in human tongue cancer cells ppt
... CTGCGGTGCTGTTGTGG CACCATCATAAGGGTAAACAT ACAGCAAAAAGGAGGCCAAA GCCACAATCCAGTCATTCCA GATAAGCTTGTGGAAGTCGCGT TCTCACTGGCCCTAAACTGG CTGATAGGGGTTGGGTGATG GCATTTCCATTTCCCTAAGCAC CAACACAATCCTGAGGCACA TCCCTTTGCCTCCTGTTGTT ... CGGAAACGCCTTAAGTCCAG AATAAGCTTCCGACTCTAGCCGC AGCTGGTGCAGGAGGAAGTA CCGAGAACCGAACTTACCAA AGGAAGCACCCAGCAATACCA CACCTTGGATGGGTATTCCA CACAGCTCCCATTCATTCCA TCCTCCCTGGAGAAGAGCTA CTCCTGGGACACGATGC CTGCGGTGCTGTTGTGG ... ovarian carcinomas, colorectal carcinomas, esophageal carcinomas, bladder carcinomas and non-small cell lung carcinomas CA9 is strongly induced by hypoxia via the transcription factor hypoxia-inducible...
- 13
- 563
- 0
Báo cáo khoa học: The modulation of metal bio-availability as a therapeutic strategy for the treatment of Alzheimer’s disease pptx
... Modulation of metal availability for treating AD P J Crouch et al research attention as potential therapeutic targets Plaques and NFTs, however, cannot be regarded as ‘upstream’ causative factors ... hyperphosphorylation occurs because of an imbalance in the activity of tau kinases and phosphatases [3] One particular tau kinase pertinent to metal dyshomeostasis in AD is glycogen synthase kinase-3 ... Oxidative damage to mitochondrial DNA is increased in Alzheimer’s disease Ann Neurol 36, 747–751 Modulation of metal availability for treating AD 81 Maynard CJ, Cappai R, Volitakis I, Cherny RA,...
- 9
- 634
- 0
a study on impacts and effectiveness of abc costing method as a cost effective measurement in coal industry
... types of costing method such as: traditional or absorption costing method, variable costing method, throughput costing method, and ABC costing method Changes in business environments requires a better ... variable costing method was used as the only and easiest way to calculate the costs This is because it is easy to accountants as well as managers and shareholders understand the directions of ... A STUDY ON IMPACTS AND EFFECTIVENESS OF ABC COSTING METHOD AS A COST EFFECTIVE MEASUREMENT IN COAL INDUSTRY BY NGUYEN THI THU HUYEN APRIL, 2011 Supervisor: Ms Nguyen Van Anh Abstract: According...
- 64
- 512
- 0
one - pot facile synthesis of iron oxide nanowires as high capacity anode
... One- pot facile synthesis of iron oxide nanowires as high capacity anode materials for lithium ion batteries Hao Liu*, David Wexler, ... 31 5-3 18 Page of 14 Caption of figures Fig X-ray diffraction pattern of alpha phase iron oxide nanowires Fig SEM and TEM Images of Fe2O3 nanowires and precursors a) The SEM image of ip t Fe2O3 nanowires ... the theoretical capacity of Fe2O3 is as high as 1005 mAh/g, which is much higher than that of the theoretical capacity of graphite anode materials (372 mAh/g) The extraction of lithium ion from...
- 15
- 384
- 0
Báo cáo khoa học: Distribution of the extrinsic proteins as a potential marker for the evolution of photosynthetic oxygen-evolving photosystem II ppt
... Chloroplast DNA Bacillariophyceae (diatoms) Thalassiosira pseudonana Nuclear DNA Chloroplast DNA Odontella sinensis Chloroplast DNA Prasinophyceae Mesostigma viride Chloroplast DNA Euglenophyceae ... glaucophyte, C paradoxa that has the most primitive plastids [23], contained the PsbV and PsbU proteins as the extrinsic proteins (Figs and 2) A primitive red alga, C caldarium that has the most ancient ... text for details), although it was not detected by the immunological assays Psb P Cyanobacteria Glaucophyceae Red algae Diatoms Haptophyceae Brown algae Prasinophyceae Euglenophyceae Green algae...
- 11
- 501
- 0
báo cáo hóa học:" The validity of self-rated health as a measure of health status among young military personnel: evidence from a cross-sectional survey" pot
... brevity and apparent validity as a marker for health and health behaviors, self-rated health may prove to be a useful tool for assessing health status among young military members Self-rated health ... health behaviors (e.g., tobacco, alcohol and drunk driving habits) to examine the validity of self-rated overall health as a measure of health status in an entire population (N = 31,108) of active ... health and healthcare needs of all military healthcare beneficiaries and to target specific health issues For instance, the Health Care Survey of DoD Beneficiaries [8] assesses a broad range of healthcare...
- 9
- 301
- 0
Báo cáo hóa học: " Hydrothermal synthesis of MnO2/CNT nanocomposite with a CNT core/porous MnO2 sheath hierarchy architecture for supercapacitors" potx
... Hydrothermal synthesis of MnO2 /CNT nanocomposite with a CNT core/porous MnO2 sheath hierarchy architecture for supercapacitors Hui Xia*1, Yu Wang2, Jianyi Lin2, and Li Lu*3 School of Materials ... electrochemical performance of the MnO2 /CNT -5- nanocomposite as an electrode material in supercapacitors was investigated Capacitive behaviors of the pristine CNT, the pure MnO2, and the MnO2 /CNT nanocomposite ... behaviors of the CNTs, the pure MnO2, and the MnO2 /CNT nanocomposite electrodes were also investigated and compared The advantages of the present MnO2 /CNT hierarchy architecture associated with its...
- 20
- 470
- 1
Báo cáo hóa học: " Biofabrication of Anisotropic Gold Nanotriangles Using Extract of Endophytic Aspergillus clavatus as a Dual Functional Reductant and Stabilizer" potx
... Cite this article as: Verma et al.: Biofabrication of Anisotropic Gold Nanotriangles Using Extract of Endophytic Aspergillus clavatus as a Dual Functional Reductant and Stabilizer Nanoscale Res ... reduction Characterization of Gold Nanotriangles Experimental Details Isolation of Endophytic Aspergillus clavatus The host plant Azadirachta indica A Juss was surveyed, and samples were randomly collected ... Vigneshwaran N, Ashtaputre NM, Varadarajan PV, Nachane RP, Paralikar KM, Balasubramanya RH: Mat Lett 2007, 61:1413 17 Bhainsa KC, D’Souza SF: Coll Surf B Biointer 2006, 47:160 18 Shankar SS, Ahmad A, ...
- 7
- 261
- 0
Báo cáo khoa học: "Alteration of nitrergic neuromuscular transmission as a result of acute experimental colitis in rat" pot
... :2 esahP gnilpmas fo yad emas eht no deyassa dna ,C°02− ni derots erew selpmas amsalp ehT amsalp eht etarapes ot g × 005,1 yletamixorppa ta nim 51 rof degufirtnec saw elpmas hcae ,noitcelloc ... dohtem yassa lacigoloiborcim a gnisu denimreted erew snoitartnecnoc emipefec amsalp ehT o dohtem lacitylanA esahp ni sa demrofrep erew serudecorp gnilpmas eht dna esod emas eht ta ylralucsumartni ... ehT )ASU ,SSPS ;0.2 noisrev( tatsamgiS ,margorp lacitsitats eht gnisu dezylana saw atad eht llA )deliat-owt( tset deriap a gnisu derapmoc erew noitcefni eht retfa dna erofeb deniatbo seulav citenikocamrahp...
- 5
- 205
- 0
Báo cáo khoa học: "Bony metastases from breast cancer - a study of foetal antigen 2 as a blood tumour markerl" doc
... osteosarcoma cells Ant Embryol (Berl) 19 92, 186 :27 1-4 doi: 10.1186/147 7-7 81 9-8 -3 8 Cite this article as: Cheung et al., Bony metastases from breast cancer - a study of foetal antigen as a blood tumour marker ... bony metastases These preliminary data point out that FA -2 is a potential helpful blood marker for bony metastases from breast cancer It would therefore appear that serum FA -2 measurement may be ... patients with both skeletal and extra-skeletal metastases FA -2 Assays The serum samples were transported at -2 0°C to the Williamson Laboratory at St Bartholomew's Hospital FA -2 radioimmunoassays...
- 4
- 286
- 0
Báo cáo y học: "Identification of a SmD3 epitope with a single symmetrical dimethylation of an arginine residue as a specific target of a subpopulation of anti-Sm antibodies" ppsx
... (Rheumaklinik Aachen, Aachen, Germany), Prof Dr MJ Fritzler (University of Calgary, Calgary, Canada) and by Labor Limbach (Heidelberg, Germany) To assess further the assay specificity, we analyzed ... studies are necessary to screen known autoantigens containing dimethylated arginine residues for epitopes assay Assay performance characteristics of the anti -SmD3 peptide (SMP) assay (a) Intra-assay ... Intra-assay and interassay variability, (b) linearity, and (c) receiver operating characteristic analysis The intra-assay and interassay variability, expressed as coefficient of variation in percentage...
- 11
- 593
- 0
Từ khóa: biological evolution of the saussurean sign as a component of the language acquisition deviceproblems of using english language as a medium of business communication in nigeriause of atomic force microscopy as a diagnostic tool to identify orthopoxvirusproblems of using english language as a medium of business communicationapplication of atomic force microscopy as a nanotechnology tool in food scienceadvantages of using case study as a teaching methodthe future of human resource management as a professionexample of application for employment as a teacherthe legal structure of the european union as a union of statestotal public expenditure on tertiary education as a percentage of public expenditure and as a percentage of gdpempirical testing of local cross entropy as a method for recovering asset apos s risk neutral pdf from option pricesc and 13 c labelling of plant cell walls as a means of assessing ligno cellulose degradationionic liquid assisted synthesis of hierarchical ceramic nanomaterials as nanofillers for electrothe clinical utility of human polymerized hemoglobins as a blood substitute following acute trauma and urgent surgerythe optic lamina of fast flying insects as a guide to neural circuit designNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThơ nôm tứ tuyệt trào phúng hồ xuân hươngChuong 2 nhận dạng rui roKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM